Transcript: Mouse NM_011737.1

Mus musculus mitogen-activated protein kinase kinase kinase 19 (Map3k19), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Map3k19 (22625)
Length:
3936
CDS:
1..3936

Additional Resources:

NCBI RefSeq record:
NM_011737.1
NBCI Gene record:
Map3k19 (22625)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347440 AGGCCGATGTGTCGTTAATAA pLKO_005 2058 CDS 100% 15.000 21.000 N Map3k19 n/a
2 TRCN0000347436 ATTAATGGATTCCGGATATAT pLKO_005 3031 CDS 100% 15.000 21.000 N Map3k19 n/a
3 TRCN0000347437 GCTCATGCCAACGGGAATAAT pLKO_005 3528 CDS 100% 15.000 21.000 N Map3k19 n/a
4 TRCN0000025312 GCCTTGGATACTTCTGATAAA pLKO.1 3223 CDS 100% 13.200 18.480 N LOC210381 n/a
5 TRCN0000025310 CCGTTCATATTGGCTAGGGAA pLKO.1 163 CDS 100% 2.640 3.696 N LOC210381 n/a
6 TRCN0000025309 CCAGGCATCTATGAGATGTTT pLKO.1 1957 CDS 100% 5.625 4.500 N LOC210381 n/a
7 TRCN0000347439 TGGTTCCATCTCTAGTATAAT pLKO_005 3384 CDS 100% 15.000 10.500 N Map3k19 n/a
8 TRCN0000347365 ATGACTTCAGCCCGTTCATAT pLKO_005 152 CDS 100% 13.200 9.240 N Map3k19 n/a
9 TRCN0000025313 GCGTCAGAAGAGGTTAGTGTT pLKO.1 1282 CDS 100% 4.950 3.465 N LOC210381 n/a
10 TRCN0000025311 GCAGATGAAATCTCCAGGAAA pLKO.1 2265 CDS 100% 4.950 2.970 N LOC210381 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12670 pDONR223 100% 11.2% 12.2% None (many diffs) n/a
2 ccsbBroad304_12670 pLX_304 0% 11.2% 12.2% V5 (many diffs) n/a
3 TRCN0000472170 GAGAGAACCACCTCTTATGACATC pLX_317 98.8% 11.2% 12.2% V5 (many diffs) n/a
4 ccsbBroadEn_15162 pDONR223 0% 11.2% 12.2% None (many diffs) n/a
5 ccsbBroad304_15162 pLX_304 0% 11.2% 12.2% V5 (many diffs) n/a
6 TRCN0000467073 TGCAGCGACGCCTCGATCAATGGT pLX_317 60.4% 11.2% 12.2% V5 (many diffs) n/a
Download CSV