Transcript: Mouse NM_011839.4

Mus musculus mab-21-like 2 (Mab21l2), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Mus musculus (mouse)
Gene:
Mab21l2 (23937)
Length:
2252
CDS:
593..1672

Additional Resources:

NCBI RefSeq record:
NM_011839.4
NBCI Gene record:
Mab21l2 (23937)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011839.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176620 CCTTCCAAACAATGTGAATTT pLKO.1 1885 3UTR 100% 13.200 9.240 N Mab21l2 n/a
2 TRCN0000181912 CAACCAGATGGGAGTCTTCAA pLKO.1 832 CDS 100% 4.950 3.465 N Mab21l2 n/a
3 TRCN0000181372 CCAGATGGGAGTCTTCAACTT pLKO.1 835 CDS 100% 4.950 3.465 N Mab21l2 n/a
4 TRCN0000181814 GCTGTAGAAACAAGTGCCTCT pLKO.1 1326 CDS 100% 2.160 1.512 N Mab21l2 n/a
5 TRCN0000197713 GCTCAATAAATACTACACCGA pLKO.1 625 CDS 100% 0.660 0.462 N Mab21l2 n/a
6 TRCN0000063794 GCGGTGGACAAGTGCAGCTAT pLKO.1 1007 CDS 100% 1.650 0.990 N MAB21L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011839.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02478 pDONR223 100% 92.3% 99.7% None (many diffs) n/a
2 TRCN0000472802 ACAAATTCCAATAGAATATCATGG pLX_317 23.3% 92.3% 99.7% V5 (many diffs) n/a
3 ccsbBroadEn_00958 pDONR223 100% 78.7% 93.8% None (many diffs) n/a
4 ccsbBroad304_00958 pLX_304 0% 78.7% 93.8% V5 (many diffs) n/a
5 TRCN0000474799 TGCACTATCACAGGATTGACTAAC pLX_317 37.1% 78.7% 93.8% V5 (many diffs) n/a
Download CSV