Transcript: Mouse NM_011917.2

Mus musculus 5'-3' exoribonuclease 2 (Xrn2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Xrn2 (24128)
Length:
3383
CDS:
63..2918

Additional Resources:

NCBI RefSeq record:
NM_011917.2
NBCI Gene record:
Xrn2 (24128)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339991 GAGATGTGTATGGCATAATAC pLKO_005 3091 3UTR 100% 13.200 18.480 N Xrn2 n/a
2 TRCN0000119960 CAACGATACTACAAGAACAAA pLKO.1 1614 CDS 100% 5.625 4.500 N Xrn2 n/a
3 TRCN0000339990 CAACGATACTACAAGAACAAA pLKO_005 1614 CDS 100% 5.625 4.500 N Xrn2 n/a
4 TRCN0000293639 TACATAGCTGATCGTTTAAAT pLKO_005 591 CDS 100% 15.000 10.500 N XRN2 n/a
5 TRCN0000339955 TACATAGCTGATCGTTTAAAT pLKO_005 591 CDS 100% 15.000 10.500 N Xrn2 n/a
6 TRCN0000339992 GAACCTAACTTCACCATAATC pLKO_005 795 CDS 100% 13.200 9.240 N Xrn2 n/a
7 TRCN0000119958 CCATTCCATTATGCACCATTT pLKO.1 1755 CDS 100% 10.800 7.560 N Xrn2 n/a
8 TRCN0000119959 CCAAATGATGTGGAGTTTGAT pLKO.1 189 CDS 100% 5.625 3.938 N Xrn2 n/a
9 TRCN0000339918 CCAAATGATGTGGAGTTTGAT pLKO_005 189 CDS 100% 5.625 3.938 N Xrn2 n/a
10 TRCN0000119957 CCAGAGGATAACGTCAGGTTA pLKO.1 1575 CDS 100% 4.950 3.465 N Xrn2 n/a
11 TRCN0000119961 GCTATTACATAGCTGATCGTT pLKO.1 586 CDS 100% 3.000 2.100 N Xrn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14067 pDONR223 100% 92.2% 75.6% None (many diffs) n/a
2 ccsbBroad304_14067 pLX_304 0% 92.2% 75.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000474266 GGCGTTAGAGCCTGAGAGGTGTGG pLX_317 13.4% 92.2% 75.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_11627 pDONR223 100% 53.3% 55.4% None (many diffs) n/a
5 ccsbBroad304_11627 pLX_304 0% 53.3% 55.4% V5 (many diffs) n/a
6 TRCN0000476296 GATGGCCTCCGTGTAGCACCTGAA pLX_317 22.7% 53.3% 55.4% V5 (many diffs) n/a
Download CSV