Transcript: Mouse NM_011971.4

Mus musculus proteasome (prosome, macropain) subunit, beta type 3 (Psmb3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Psmb3 (26446)
Length:
731
CDS:
55..672

Additional Resources:

NCBI RefSeq record:
NM_011971.4
NBCI Gene record:
Psmb3 (26446)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011971.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031933 GCGTCTCAAGTTCCGACTGAA pLKO.1 249 CDS 100% 4.950 6.930 N Psmb3 n/a
2 TRCN0000031931 CTCCGAACAAATGTATGGGAT pLKO.1 480 CDS 100% 2.640 3.696 N Psmb3 n/a
3 TRCN0000092077 GCTCCGAACAAATGTATGGGA pLKO.1 479 CDS 100% 0.750 1.050 N Gm4950 n/a
4 TRCN0000092076 ACCTGCTCCGAACAAATGTAT pLKO.1 475 CDS 100% 5.625 4.500 N Gm4950 n/a
5 TRCN0000295142 CCATGGTGACTGATGACTTTG pLKO_005 443 CDS 100% 10.800 7.560 N Psmb3 n/a
6 TRCN0000295191 CGGACTTCCAGAAGATCTTTC pLKO_005 164 CDS 100% 10.800 7.560 N Psmb3 n/a
7 TRCN0000295143 ATCGCTGCAGACAGACGTTTC pLKO_005 118 CDS 100% 6.000 4.200 N Psmb3 n/a
8 TRCN0000031929 CTGAACTTGTATGAGCTGAAA pLKO.1 265 CDS 100% 4.950 3.465 N Psmb3 n/a
9 TRCN0000031930 GAACACCTGTTTGAAACCATT pLKO.1 535 CDS 100% 4.950 3.465 N Psmb3 n/a
10 TRCN0000287806 GAACACCTGTTTGAAACCATT pLKO_005 535 CDS 100% 4.950 3.465 N Psmb3 n/a
11 TRCN0000031932 GAAGACCTTCAAGCCCTTCAT pLKO.1 396 CDS 100% 4.950 2.970 N Psmb3 n/a
12 TRCN0000287733 GAAGACCTTCAAGCCCTTCAT pLKO_005 396 CDS 100% 4.950 2.970 N Psmb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011971.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01311 pDONR223 100% 91% 98.5% None (many diffs) n/a
2 ccsbBroad304_01311 pLX_304 0% 91% 98.5% V5 (many diffs) n/a
3 TRCN0000471203 CGCCACATCTCCACATATGGGTTT pLX_317 62.8% 91% 98.5% V5 (many diffs) n/a
Download CSV