Transcript: Mouse NM_012038.4

Mus musculus visinin-like 1 (Vsnl1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Vsnl1 (26950)
Length:
1951
CDS:
299..874

Additional Resources:

NCBI RefSeq record:
NM_012038.4
NBCI Gene record:
Vsnl1 (26950)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_012038.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104715 GCCTTAATTCTTACCTCATTT pLKO.1 1434 3UTR 100% 13.200 10.560 N Vsnl1 n/a
2 TRCN0000055466 GACCCTTCCATTGTATTACTT pLKO.1 830 CDS 100% 5.625 3.938 N VSNL1 n/a
3 TRCN0000104718 TGGGCTTTCAACATGTATGAT pLKO.1 605 CDS 100% 5.625 3.938 N Vsnl1 n/a
4 TRCN0000104717 AGTTCAATGAGCATGAGCTTA pLKO.1 360 CDS 100% 4.950 3.465 N Vsnl1 n/a
5 TRCN0000104716 CCAGCAGCTCTATGTGAAGTT pLKO.1 442 CDS 100% 4.950 3.465 N Vsnl1 n/a
6 TRCN0000055463 CCAGATTACACTGGATGAATT pLKO.1 790 CDS 100% 0.000 0.000 N VSNL1 n/a
7 TRCN0000104719 GCTGGAGATTATCGAGGCTAT pLKO.1 661 CDS 100% 4.050 2.430 N Vsnl1 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 934 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012038.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07132 pDONR223 100% 91.6% 99.4% None (many diffs) n/a
2 ccsbBroad304_07132 pLX_304 0% 91.6% 99.4% V5 (many diffs) n/a
3 TRCN0000478956 GGGCGAGAATCGAAAAATCGCACT pLX_317 60% 91.6% 99.4% V5 (many diffs) n/a
4 ccsbBroadEn_08291 pDONR223 100% 82.3% 89% None (many diffs) n/a
5 ccsbBroad304_08291 pLX_304 0% 82.3% 89% V5 (many diffs) n/a
6 TRCN0000467506 CTTTGTACGCTATGCCTAGTGATC pLX_317 62.5% 82.3% 89% V5 (many diffs) n/a
Download CSV