Transcript: Human NM_012232.6

Homo sapiens caveolae associated protein 1 (CAVIN1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CAVIN1 (284119)
Length:
3570
CDS:
160..1332

Additional Resources:

NCBI RefSeq record:
NM_012232.6
NBCI Gene record:
CAVIN1 (284119)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012232.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430242 CCTACTAGAAGGACGTGAAAG pLKO_005 1809 3UTR 100% 10.800 15.120 N CAVIN1 n/a
2 TRCN0000424879 CGAACTTCCTCTTTCGCATTC pLKO_005 1372 3UTR 100% 6.000 8.400 N CAVIN1 n/a
3 TRCN0000053058 CCGCAACTTTAAAGTCATGAT pLKO.1 603 CDS 100% 4.950 6.930 N CAVIN1 n/a
4 TRCN0000422120 GACAAGTTGCGCAAATCCTTC pLKO_005 1042 CDS 100% 4.050 5.670 N CAVIN1 n/a
5 TRCN0000053060 GAGCATCAGCAAATCGCTGAA pLKO.1 657 CDS 100% 0.405 0.567 N CAVIN1 n/a
6 TRCN0000053059 GTGGAGGTTGAGGAGGTTATT pLKO.1 778 CDS 100% 13.200 9.240 N CAVIN1 n/a
7 TRCN0000419380 ATGGGAAGGGAATGGTCAATC pLKO_005 1550 3UTR 100% 10.800 7.560 N CAVIN1 n/a
8 TRCN0000306090 AGGTCAGCGTCAACGTGAAGA pLKO_005 506 CDS 100% 4.950 3.465 N Cavin1 n/a
9 TRCN0000446514 GAGAAGCGCATGAACAAGCTG pLKO_005 970 CDS 100% 2.640 1.848 N CAVIN1 n/a
10 TRCN0000433482 ACAAGAGCGACAGCGACTGAG pLKO_005 1313 CDS 100% 1.350 0.945 N CAVIN1 n/a
11 TRCN0000438026 CAATACGGTGAGCAAGCTGCT pLKO_005 471 CDS 100% 2.160 1.296 N CAVIN1 n/a
12 TRCN0000053062 CCTGGAGAAGACGCGCCTCAA pLKO.1 912 CDS 100% 0.000 0.000 N CAVIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012232.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09954 pDONR223 100% 99.9% 100% None 882G>A n/a
2 ccsbBroad304_09954 pLX_304 0% 99.9% 100% V5 882G>A n/a
3 TRCN0000475656 GTCAGAGCATTTCGTGACATGCTT pLX_317 18% 99.9% 100% V5 882G>A n/a
Download CSV