Transcript: Human NM_012290.5

Homo sapiens tousled like kinase 1 (TLK1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
TLK1 (9874)
Length:
5723
CDS:
466..2766

Additional Resources:

NCBI RefSeq record:
NM_012290.5
NBCI Gene record:
TLK1 (9874)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147425 AGGCTAACTGTGATCTCAGA pXPR_003 CGG 747 32% 9 0.2549 TLK1 TLK1 75995
2 BRDN0001147793 GATTTACTGGAGTTGCAAGT pXPR_003 GGG 213 9% 2 0.1848 TLK1 TLK1 75996
3 BRDN0001146841 TAACTGTTGTAAAGTGCCCG pXPR_003 AGG 902 39% 10 -0.1128 TLK1 TLK1 75997
4 BRDN0001145691 GAAACAATCGGAATCATCCA pXPR_003 GGG 358 16% 4 -0.2230 TLK1 TLK1 75994
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012290.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196405 GAGAGTATAGAATACACAAAG pLKO.1 1985 CDS 100% 10.800 15.120 N TLK1 n/a
2 TRCN0000007059 CGGTCTATTGTAATGCAGATT pLKO.1 2149 CDS 100% 4.950 3.960 N TLK1 n/a
3 TRCN0000194995 CCCTTCTAGCTCTATTGTAAA pLKO.1 3631 3UTR 100% 13.200 9.240 N TLK1 n/a
4 TRCN0000352906 CCCTTCTAGCTCTATTGTAAA pLKO_005 3631 3UTR 100% 13.200 9.240 N TLK1 n/a
5 TRCN0000007056 GCTGAAATTGTAGAGAGTATA pLKO.1 4323 3UTR 100% 13.200 9.240 N TLK1 n/a
6 TRCN0000196858 GCATTTATAAGACGCTGTTTG pLKO.1 2590 CDS 100% 10.800 7.560 N TLK1 n/a
7 TRCN0000007060 CCCACACATGAGAAGATCAAA pLKO.1 2670 CDS 100% 5.625 3.938 N TLK1 n/a
8 TRCN0000342397 CCCACACATGAGAAGATCAAA pLKO_005 2670 CDS 100% 5.625 3.938 N TLK1 n/a
9 TRCN0000195439 CCACCCTATTGTACAACCAAA pLKO.1 1059 CDS 100% 4.950 3.465 N TLK1 n/a
10 TRCN0000079015 CCCAGAATAGTTAAACTCTAT pLKO.1 2017 CDS 100% 4.950 3.465 N Tlk1 n/a
11 TRCN0000007058 GCCACCAAAGATTTCCAACAA pLKO.1 2406 CDS 100% 4.950 3.465 N TLK1 n/a
12 TRCN0000007057 CGGAGAAGAAACAATCGGAAT pLKO.1 800 CDS 100% 4.050 2.835 N TLK1 n/a
13 TRCN0000195357 CCAGTTCTATGCAGGATAATG pLKO.1 3603 3UTR 100% 13.200 7.920 N TLK1 n/a
14 TRCN0000342358 CCAGTTCTATGCAGGATAATG pLKO_005 3603 3UTR 100% 13.200 7.920 N TLK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012290.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487936 ACAGCAAACCTACTCCTACTAAAT pLX_317 13% 100% 100% V5 (not translated due to prior stop codon) n/a
2 ccsbBroadEn_14947 pDONR223 0% 99.9% 100% None 900C>T n/a
3 ccsbBroad304_14947 pLX_304 0% 99.9% 100% V5 900C>T n/a
4 TRCN0000480520 ACATAAGTTTACCCGAGAACGCGG pLX_317 14.1% 99.9% 100% V5 900C>T n/a
Download CSV