Transcript: Human NM_013361.6

Homo sapiens zinc finger protein 223 (ZNF223), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ZNF223 (7766)
Length:
2399
CDS:
229..1677

Additional Resources:

NCBI RefSeq record:
NM_013361.6
NBCI Gene record:
ZNF223 (7766)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013361.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329833 TCCAATTGTGGGAAGTGTAAA pLKO_005 670 CDS 100% 13.200 18.480 N ZNF223 n/a
2 TRCN0000013063 CCTCTTATCTACCTGTACTTT pLKO.1 1885 3UTR 100% 5.625 4.500 N ZNF223 n/a
3 TRCN0000329910 ACGTAAGTGTTGTACATATTT pLKO_005 1672 CDS 100% 15.000 10.500 N ZNF223 n/a
4 TRCN0000329908 ACATTTATCACCTCAATTATC pLKO_005 1759 3UTR 100% 13.200 9.240 N ZNF223 n/a
5 TRCN0000329909 CCTCAAGACTCTACCATAAAG pLKO_005 568 CDS 100% 13.200 9.240 N ZNF223 n/a
6 TRCN0000013064 GCCTCAAGACTCTACCATAAA pLKO.1 567 CDS 100% 13.200 9.240 N ZNF223 n/a
7 TRCN0000013066 CTTCAGTGATATGTCCATCTT pLKO.1 696 CDS 100% 4.950 3.465 N ZNF223 n/a
8 TRCN0000013065 GCTTCATTCGTAGGCTGGATT pLKO.1 1199 CDS 100% 4.950 3.465 N ZNF223 n/a
9 TRCN0000329907 GCTTCATTCGTAGGCTGGATT pLKO_005 1199 CDS 100% 4.950 3.465 N ZNF223 n/a
10 TRCN0000013067 TGAGATATGTAGTGTGAGCTT pLKO.1 1098 CDS 100% 2.640 1.848 N ZNF223 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013361.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07176 pDONR223 100% 99.7% 99.7% None (many diffs) n/a
2 ccsbBroad304_07176 pLX_304 0% 99.7% 99.7% V5 (many diffs) n/a
3 TRCN0000481658 CTCCTGAACCAAGTGGAAAACCTC pLX_317 1.5% 99.7% 99.7% V5 (many diffs) n/a
4 ccsbBroadEn_01823 pDONR223 100% 85.9% 78.2% None (many diffs) n/a
5 ccsbBroad304_01823 pLX_304 0% 85.9% 78.2% V5 (many diffs) n/a
6 TRCN0000476788 CTGCGAAGACGGCAACATCAGATA pLX_317 29.8% 85.9% 78.2% V5 (many diffs) n/a
7 ccsbBroadEn_07167 pDONR223 100% 78.6% 71% None (many diffs) n/a
8 ccsbBroad304_07167 pLX_304 0% 78.6% 71% V5 (many diffs) n/a
9 TRCN0000472100 CATTCGAGTACGACGCCCGCGCAT pLX_317 28.8% 78.6% 71% V5 (many diffs) n/a
Download CSV