Transcript: Mouse NM_013534.4

Mus musculus prolyl 3-hydroxylase 3 (P3h3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
P3h3 (14789)
Length:
2779
CDS:
1..2199

Additional Resources:

NCBI RefSeq record:
NM_013534.4
NBCI Gene record:
P3h3 (14789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013534.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200430 GCCTACACCTATCGAGACTAT pLKO.1 1795 CDS 100% 4.950 6.930 N P3h3 n/a
2 TRCN0000197900 GAGAGAAGAGACAGTTATATT pLKO.1 1142 CDS 100% 15.000 10.500 N P3h3 n/a
3 TRCN0000178245 GCAGAGCAACTGCTTCTAATA pLKO.1 2477 3UTR 100% 13.200 9.240 N P3h3 n/a
4 TRCN0000319995 GCAGAGCAACTGCTTCTAATA pLKO_005 2477 3UTR 100% 13.200 9.240 N P3h3 n/a
5 TRCN0000176802 GCAACTGCTTCTAATAAGAAA pLKO.1 2482 3UTR 100% 5.625 3.938 N P3h3 n/a
6 TRCN0000182541 GTGCAGAGCAACTGCTTCTAA pLKO.1 2475 3UTR 100% 5.625 3.938 N P3h3 n/a
7 TRCN0000182869 CTCGGAGAGAAGAGACAGTTA pLKO.1 1138 CDS 100% 4.950 3.465 N P3h3 n/a
8 TRCN0000319994 CTCGGAGAGAAGAGACAGTTA pLKO_005 1138 CDS 100% 4.950 3.465 N P3h3 n/a
9 TRCN0000182324 GCTCTGAACCAGTACCAAACT pLKO.1 1051 CDS 100% 4.950 3.465 N P3h3 n/a
10 TRCN0000319993 GCTCTGAACCAGTACCAAACT pLKO_005 1051 CDS 100% 4.950 3.465 N P3h3 n/a
11 TRCN0000198365 GCTAAGTACAGAAGGATGTCT pLKO.1 577 CDS 100% 3.000 2.100 N P3h3 n/a
12 TRCN0000200265 CCTTCTTTGTGGCAAACCCAA pLKO.1 530 CDS 100% 2.640 1.848 N P3h3 n/a
13 TRCN0000198428 GAAGAAGAGGAGGAAGACATT pLKO.1 2077 CDS 100% 4.950 2.970 N P3h3 n/a
14 TRCN0000182745 CCAGAGTTCAAATCCCAGCAA pLKO.1 2563 3UTR 100% 2.640 1.320 Y P3h3 n/a
15 TRCN0000320070 CCAGAGTTCAAATCCCAGCAA pLKO_005 2563 3UTR 100% 2.640 1.320 Y P3h3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013534.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11518 pDONR223 100% 64.1% 65.3% None (many diffs) n/a
2 ccsbBroad304_11518 pLX_304 0% 64.1% 65.3% V5 (many diffs) n/a
3 TRCN0000470017 GGCCCGTAATGAACACTACGATGC pLX_317 26.5% 64.1% 65.3% V5 (many diffs) n/a
Download CSV