Transcript: Mouse NM_013570.1

Mus musculus keratin 33B (Krt33b), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Krt33b (16671)
Length:
1596
CDS:
44..1258

Additional Resources:

NCBI RefSeq record:
NM_013570.1
NBCI Gene record:
Krt33b (16671)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013570.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090463 TCAGCCTCTTTGAACCCACAT pLKO.1 1317 3UTR 100% 4.050 2.835 N Krt33b n/a
2 TRCN0000090464 CTGCAATTCCTTTGGCTGCTA pLKO.1 1237 CDS 100% 2.640 1.848 N Krt33b n/a
3 TRCN0000090467 CTTGTGTCACACGCTCCCGAT pLKO.1 1209 CDS 100% 0.720 0.504 N Krt33b n/a
4 TRCN0000090465 CATTGGACCCTGTGTCACAAA pLKO.1 1186 CDS 100% 4.950 2.970 N Krt33b n/a
5 TRCN0000090466 GCAGAAGATTCTCTGTGGCAA pLKO.1 385 CDS 100% 2.640 1.584 N Krt33b n/a
6 TRCN0000089802 CATGAGAAACTCTCTGGAGAA pLKO.1 916 CDS 100% 4.050 2.025 Y Krt34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013570.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00921 pDONR223 100% 87.5% 86.8% None (many diffs) n/a
2 ccsbBroad304_00921 pLX_304 0% 87.5% 86.8% V5 (many diffs) n/a
3 ccsbBroadEn_00920 pDONR223 100% 84.5% 85.3% None (many diffs) n/a
4 ccsbBroad304_00920 pLX_304 0% 84.5% 85.3% V5 (many diffs) n/a
5 TRCN0000467714 ATTAGCGGGGACGAAACGTTTAGA pLX_317 35% 84.5% 85.3% V5 (many diffs) n/a
6 ccsbBroadEn_06510 pDONR223 100% 75.8% 74.6% None (many diffs) n/a
7 ccsbBroad304_06510 pLX_304 0% 75.8% 74.6% V5 (many diffs) n/a
8 TRCN0000477279 GGCACAGACCCCCTATCAGTTGAG pLX_317 24% 75.8% 74.6% V5 (many diffs) n/a
Download CSV