Transcript: Mouse NM_013586.4

Mus musculus lysyl oxidase-like 3 (Loxl3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Loxl3 (16950)
Length:
4049
CDS:
94..2358

Additional Resources:

NCBI RefSeq record:
NM_013586.4
NBCI Gene record:
Loxl3 (16950)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013586.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341033 GGTCGTTATCAACCCAAATTT pLKO_005 2172 CDS 100% 15.000 21.000 N Loxl3 n/a
2 TRCN0000076700 CAGGTCGTTATCAACCCAAAT pLKO.1 2170 CDS 100% 10.800 15.120 N Loxl3 n/a
3 TRCN0000076699 GCCCTCTTTATGCCACCTTTA pLKO.1 947 CDS 100% 10.800 15.120 N Loxl3 n/a
4 TRCN0000352548 GGTATGAGTGCGCCAACTTTG pLKO_005 2048 CDS 100% 10.800 15.120 N Loxl3 n/a
5 TRCN0000341107 CTAGTAACCAGATCGTCTAAA pLKO_005 2339 CDS 100% 0.000 0.000 N Loxl3 n/a
6 TRCN0000341105 CCGCGTTACCTCTAGCCATTT pLKO_005 2704 3UTR 100% 10.800 7.560 N Loxl3 n/a
7 TRCN0000341035 GAGGGCCACAAAGCTAGTTTC pLKO_005 1987 CDS 100% 10.800 7.560 N Loxl3 n/a
8 TRCN0000076701 CAACAATGCAATGAAGTGTAA pLKO.1 2217 CDS 100% 4.950 3.465 N Loxl3 n/a
9 TRCN0000076702 CTAGAGTTCTATCGTGCCAAT pLKO.1 874 CDS 100% 4.050 2.835 N Loxl3 n/a
10 TRCN0000076698 GCCCAGGATAACTTTATGAAT pLKO.1 3241 3UTR 100% 5.625 3.375 N Loxl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013586.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12839 pDONR223 100% 71.8% 76% None (many diffs) n/a
2 ccsbBroad304_12839 pLX_304 0% 71.8% 76% V5 (many diffs) n/a
3 TRCN0000468852 ACCGGGGCCACAGCCACGAGAGTT pLX_317 20% 71.8% 76% V5 (many diffs) n/a
Download CSV