Transcript: Mouse NM_013610.2

Mus musculus ninjurin 1 (Ninj1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ninj1 (18081)
Length:
1132
CDS:
17..475

Additional Resources:

NCBI RefSeq record:
NM_013610.2
NBCI Gene record:
Ninj1 (18081)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013610.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108466 CGGCCCATCAATGTAAACCAT pLKO.1 116 CDS 100% 3.000 4.200 N Ninj1 n/a
2 TRCN0000304806 TAGAACGCCCAGAGACTTTAA pLKO_005 473 CDS 100% 13.200 9.240 N Ninj1 n/a
3 TRCN0000374417 CGTGGTCAACATCTTCATTAC pLKO_005 406 CDS 100% 10.800 7.560 N Ninj1 n/a
4 TRCN0000108469 TGTAAACCATTATGCCAACAA pLKO.1 127 CDS 100% 4.950 3.465 N Ninj1 n/a
5 TRCN0000316491 TGTAAACCATTATGCCAACAA pLKO_005 127 CDS 100% 4.950 3.465 N Ninj1 n/a
6 TRCN0000108465 GCCATGAAGATCAGAACTGGA pLKO.1 674 3UTR 100% 2.640 1.848 N Ninj1 n/a
7 TRCN0000316492 GCCATGAAGATCAGAACTGGA pLKO_005 674 3UTR 100% 2.640 1.848 N Ninj1 n/a
8 TRCN0000108467 CCTGGTCAAGTATGACCTCAA pLKO.1 316 CDS 100% 0.405 0.284 N Ninj1 n/a
9 TRCN0000316490 CCTGGTCAAGTATGACCTCAA pLKO_005 316 CDS 100% 0.405 0.284 N Ninj1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013610.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01099 pDONR223 100% 87% 89.4% None (many diffs) n/a
2 ccsbBroad304_01099 pLX_304 0% 87% 89.4% V5 (many diffs) n/a
3 TRCN0000474530 CTGTTACGGCCGAGCGTTCAACTC pLX_317 67.8% 87% 89.4% V5 (many diffs) n/a
4 ccsbBroadEn_06641 pDONR223 100% 86.8% 88.8% None (many diffs) n/a
5 ccsbBroad304_06641 pLX_304 0% 86.8% 88.8% V5 (many diffs) n/a
6 TRCN0000466561 AGGAGTTACCTCAATTTCCTCCTG pLX_317 78.9% 86.8% 88.8% V5 (many diffs) n/a
Download CSV