Transcript: Human NM_014298.5

Homo sapiens quinolinate phosphoribosyltransferase (QPRT), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
QPRT (23475)
Length:
2200
CDS:
19..912

Additional Resources:

NCBI RefSeq record:
NM_014298.5
NBCI Gene record:
QPRT (23475)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014298.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376580 CTTCGCTCTGAAGGTGGAAGT pLKO_005 597 CDS 100% 4.050 5.670 N QPRT n/a
2 TRCN0000370273 TCAACTACGCAGCCTTGGTCA pLKO_005 107 CDS 100% 2.640 3.696 N QPRT n/a
3 TRCN0000034848 TGCCATATTTACCCAACTCAA pLKO.1 201 CDS 100% 4.950 3.960 N QPRT n/a
4 TRCN0000365169 AGCCTTTCTTCGATGCCATAT pLKO_005 188 CDS 100% 10.800 7.560 N QPRT n/a
5 TRCN0000370218 GCTCATCTCAGTTTCCTAATC pLKO_005 1087 3UTR 100% 10.800 7.560 N QPRT n/a
6 TRCN0000365157 TGGTGATGGTGAAGGATAACC pLKO_005 518 CDS 100% 4.950 3.465 N QPRT n/a
7 TRCN0000034845 AGCCCTTGATTTCTCCCTCAA pLKO.1 849 CDS 100% 4.050 2.835 N QPRT n/a
8 TRCN0000034844 CAGCCTTTCTTCGATGCCATA pLKO.1 187 CDS 100% 4.050 2.835 N QPRT n/a
9 TRCN0000034847 TCCCTCAAGCTGTTTGCCAAA pLKO.1 862 CDS 100% 4.050 2.835 N QPRT n/a
10 TRCN0000034846 GTGATGGTGAAGGATAACCAT pLKO.1 520 CDS 100% 0.300 0.210 N QPRT n/a
11 TRCN0000377477 CTAGTCCTAAACCGGAAGAGG pLKO_005 909 CDS 100% 0.000 0.000 N QPRT n/a
12 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1224 3UTR 100% 4.950 2.475 Y CFLAR n/a
13 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1224 3UTR 100% 4.950 2.475 Y C19orf31 n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1222 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1222 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1222 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1391 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014298.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15762 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15762 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473232 CCTCTGTTATACTCCGCTGCAGGG pLX_317 45.9% 100% 100% V5 n/a
4 ccsbBroadEn_07889 pDONR223 100% 99.8% 99.6% None 157G>A n/a
5 ccsbBroad304_07889 pLX_304 0% 99.8% 99.6% V5 157G>A n/a
6 TRCN0000466332 TAGGTTGCAGCCCCCAGTGCCACG pLX_317 31.7% 99.8% 99.6% V5 157G>A n/a
Download CSV