Transcript: Human NM_014488.5

Homo sapiens RAB30, member RAS oncogene family (RAB30), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
RAB30 (27314)
Length:
9960
CDS:
317..928

Additional Resources:

NCBI RefSeq record:
NM_014488.5
NBCI Gene record:
RAB30 (27314)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014488.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000455024 GTTACTACCGAAGCGCCAATG pLKO_005 546 CDS 100% 6.000 8.400 N RAB30 n/a
2 TRCN0000100401 CAGCTATTTGACTTGTTGTAA pLKO.1 898 CDS 100% 5.625 7.875 N Rab30 n/a
3 TRCN0000047829 CAAGAGAGATTTCGGTCCATT pLKO.1 518 CDS 100% 4.950 6.930 N RAB30 n/a
4 TRCN0000100402 CGAAGATTCACTCAGGGTCTT pLKO.1 395 CDS 100% 4.050 5.670 N Rab30 n/a
5 TRCN0000047830 CTGCGGGAGATAGAACAATAT pLKO.1 626 CDS 100% 13.200 9.240 N RAB30 n/a
6 TRCN0000047831 GAAGATTCACTCAGGGTCTTT pLKO.1 396 CDS 100% 4.950 3.465 N RAB30 n/a
7 TRCN0000047828 GCATCAGCTATTTGACTTGTT pLKO.1 894 CDS 100% 4.950 3.465 N RAB30 n/a
8 TRCN0000047832 GAACAATGTATCCTCACCCTT pLKO.1 856 CDS 100% 2.640 1.848 N RAB30 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014488.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03027 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03027 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468748 ATTTCAACAACACGAGCGACACAT pLX_317 81% 100% 100% V5 n/a
Download CSV