Transcript: Human NM_014584.3

Homo sapiens endoplasmic reticulum oxidoreductase 1 alpha (ERO1A), mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
ERO1A (30001)
Length:
5139
CDS:
78..1484

Additional Resources:

NCBI RefSeq record:
NM_014584.3
NBCI Gene record:
ERO1A (30001)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014584.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059755 GCCAGAAAGTGGACCTAGTTA pLKO.1 1349 CDS 100% 5.625 7.875 N ERO1A n/a
2 TRCN0000300619 GCCAGAAAGTGGACCTAGTTA pLKO_005 1349 CDS 100% 5.625 7.875 N ERO1A n/a
3 TRCN0000304043 CCTCATAAATGACCCATAATT pLKO_005 1871 3UTR 100% 15.000 12.000 N ERO1A n/a
4 TRCN0000059753 GCGAGCTACAAGTATTCTGAA pLKO.1 423 CDS 100% 4.950 3.960 N ERO1A n/a
5 TRCN0000304042 ACTGCTCTGAAGATCTTATTT pLKO_005 1305 CDS 100% 15.000 10.500 N ERO1A n/a
6 TRCN0000059757 CACAAACTAAAGGAGGACTTT pLKO.1 1191 CDS 100% 4.950 3.465 N ERO1A n/a
7 TRCN0000300621 CACAAACTAAAGGAGGACTTT pLKO_005 1191 CDS 100% 4.950 3.465 N ERO1A n/a
8 TRCN0000059756 GCCAATAATCTCATTGAAGAA pLKO.1 447 CDS 100% 4.950 3.465 N ERO1A n/a
9 TRCN0000059754 GCTGAATATGTAGATTTGCTT pLKO.1 603 CDS 100% 3.000 2.100 N ERO1A n/a
10 TRCN0000300620 GCTGAATATGTAGATTTGCTT pLKO_005 603 CDS 100% 3.000 2.100 N ERO1A n/a
11 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 2404 3UTR 100% 15.000 7.500 Y KAAG1 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3692 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3692 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014584.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03129 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03129 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470532 ACTTCATCAGCAGTGAGAATTCCA pLX_317 35.3% 100% 100% V5 n/a
4 ccsbBroadEn_08159 pDONR223 100% 99.9% 99.7% None 1366G>A n/a
5 ccsbBroad304_08159 pLX_304 0% 99.9% 99.7% V5 1366G>A n/a
6 TRCN0000475249 CAGTCCCCTTTAGGCCATTCGAAA pLX_317 28.5% 99.9% 99.7% V5 1366G>A n/a
Download CSV