Transcript: Human NM_014693.4

Homo sapiens EEF1AKMT4-ECE2 readthrough (EEF1AKMT4-ECE2), mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
EEF1AKMT4-ECE2 (110599583)
Length:
3468
CDS:
24..2675

Additional Resources:

NCBI RefSeq record:
NM_014693.4
NBCI Gene record:
EEF1AKMT4-ECE2 (110599583)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014693.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046972 CCTCTCGGGATTACTACTTAA pLKO.1 1153 CDS 100% 13.200 6.600 Y ECE2 n/a
2 TRCN0000031177 GATGCCATCTATGATATGATT pLKO.1 1854 CDS 100% 5.625 2.813 Y Ece2 n/a
3 TRCN0000046968 GCACAAGCCTTAGCAAATGAT pLKO.1 3307 3UTR 100% 5.625 2.813 Y ECE2 n/a
4 TRCN0000046969 GCTGCCTACAATGCTTACAAA pLKO.1 2391 CDS 100% 5.625 2.813 Y ECE2 n/a
5 TRCN0000046970 CCTTCCAACTAAGAATGAGAT pLKO.1 2069 CDS 100% 4.950 2.475 Y ECE2 n/a
6 TRCN0000046971 CCATCTATGATATGATTGGTT pLKO.1 1858 CDS 100% 3.000 1.500 Y ECE2 n/a
7 TRCN0000157876 CTTCCCTAATGTGACCAGTGT pLKO.1 263 CDS 100% 2.640 1.320 Y ECE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014693.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07474 pDONR223 100% 82.7% 81.8% None (many diffs) n/a
2 ccsbBroad304_07474 pLX_304 0% 82.7% 81.8% V5 (many diffs) n/a
3 TRCN0000475472 CCGCGACCCTACGAAGCCATTGCC pLX_317 13.3% 82.7% 81.8% V5 (many diffs) n/a
4 ccsbBroadEn_07473 pDONR223 100% 25% 19.5% None (many diffs) n/a
5 ccsbBroad304_07473 pLX_304 0% 25% 19.5% V5 (many diffs) n/a
6 TRCN0000481413 CTAGACGACTTGACTGCAGTCGAC pLX_317 22.8% 25% 19.5% V5 (many diffs) n/a
7 TRCN0000488998 GATTCCACCCGGTGTCTGGGTCAA pLX_317 46.9% 25% 19.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV