Transcript: Human NM_015288.6

Homo sapiens jade family PHD finger 2 (JADE2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
JADE2 (23338)
Length:
6462
CDS:
180..2552

Additional Resources:

NCBI RefSeq record:
NM_015288.6
NBCI Gene record:
JADE2 (23338)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015288.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018514 GCCTGGAAATGCGGACTATAT pLKO.1 1204 CDS 100% 13.200 18.480 N JADE2 n/a
2 TRCN0000018515 GCTCATCAACTCGGAGCTTAA pLKO.1 623 CDS 100% 10.800 15.120 N JADE2 n/a
3 TRCN0000018516 CGACATCTACATCCGCATCAA pLKO.1 244 CDS 100% 4.950 6.930 N JADE2 n/a
4 TRCN0000018513 GCGGACTATATTAGCAGACAA pLKO.1 1214 CDS 100% 4.950 6.930 N JADE2 n/a
5 TRCN0000359552 GCTATGACTTGGACGAGATTG pLKO_005 586 CDS 100% 10.800 8.640 N JADE2 n/a
6 TRCN0000359623 GGCCTGGAAATGCGGACTATA pLKO_005 1203 CDS 100% 13.200 9.240 N JADE2 n/a
7 TRCN0000378302 CATCACCAAGATCTCGCATAT pLKO_005 1064 CDS 100% 10.800 7.560 N JADE2 n/a
8 TRCN0000018517 ACGTCGGACATCTTCTCACTT pLKO.1 2123 CDS 100% 4.950 3.465 N JADE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015288.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11722 pDONR223 100% 99.8% 99.8% None 1550_1551insAGC n/a
2 ccsbBroad304_11722 pLX_304 0% 99.8% 99.8% V5 1550_1551insAGC n/a
3 TRCN0000472266 TAGGATTCGATGTGTTACGACTGG pLX_317 17.6% 99.8% 99.8% V5 1550_1551insAGC n/a
4 ccsbBroadEn_14078 pDONR223 100% 31% 30.8% None 1_1632del;2221G>A;2369C>T n/a
5 ccsbBroad304_14078 pLX_304 0% 31% 30.8% V5 1_1632del;2221G>A;2369C>T n/a
6 TRCN0000467725 ACACATTCATGTACTTGTTACGCA pLX_317 55.8% 31% 30.8% V5 1_1632del;2221G>A;2369C>T n/a
Download CSV