Transcript: Human NM_015328.4

Homo sapiens adenosylhomocysteinase like 2 (AHCYL2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
AHCYL2 (23382)
Length:
5049
CDS:
48..1883

Additional Resources:

NCBI RefSeq record:
NM_015328.4
NBCI Gene record:
AHCYL2 (23382)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015328.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050167 GCAGAGTTTGGACGAAGAGAA pLKO.1 627 CDS 100% 4.950 6.930 N AHCYL2 n/a
2 TRCN0000050165 CCGTATGAAGAATAGCTGCAT pLKO.1 1448 CDS 100% 2.640 3.696 N AHCYL2 n/a
3 TRCN0000050163 CCAAACATGATCTTGGATGAT pLKO.1 957 CDS 100% 4.950 3.465 N AHCYL2 n/a
4 TRCN0000050166 GCTCTAGCAGAAAGTGGATTT pLKO.1 855 CDS 100% 10.800 6.480 N AHCYL2 n/a
5 TRCN0000050164 GCCTTGATAGAGCTTTACAAT pLKO.1 1683 CDS 100% 5.625 3.375 N AHCYL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015328.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02757 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02757 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481020 AAAGACACGACGTGGTCGTCTCCA pLX_317 22% 100% 100% V5 n/a
4 ccsbBroadEn_11546 pDONR223 100% 64.9% 75.4% None (many diffs) n/a
5 ccsbBroad304_11546 pLX_304 0% 64.9% 75.4% V5 (many diffs) n/a
6 TRCN0000478243 TCTTTAAGGATATACCGATCACAC pLX_317 17.6% 64.9% 75.4% V5 (many diffs) n/a
Download CSV