Transcript: Human NM_015534.6

Homo sapiens zinc finger ZZ-type containing 3 (ZZZ3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ZZZ3 (26009)
Length:
6412
CDS:
477..3188

Additional Resources:

NCBI RefSeq record:
NM_015534.6
NBCI Gene record:
ZZZ3 (26009)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015534.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135454 GAGATCGTATGGGACCAATAT pLKO.1 2166 CDS 100% 13.200 18.480 N ZZZ3 n/a
2 TRCN0000365156 GATCGTATGGGACCAATATAC pLKO_005 2168 CDS 100% 13.200 18.480 N ZZZ3 n/a
3 TRCN0000336315 TTCCCGATCTACTCGTGTTAC pLKO_005 485 CDS 100% 10.800 15.120 N Zzz3 n/a
4 TRCN0000370301 TTCCCGATCTACTCGTGTTAC pLKO_005 485 CDS 100% 10.800 15.120 N ZZZ3 n/a
5 TRCN0000135859 CGCATCCTGAAGAAATCTCTT pLKO.1 577 CDS 100% 4.950 3.960 N ZZZ3 n/a
6 TRCN0000370272 GACGACAGCACCCTCTTAATA pLKO_005 2668 CDS 100% 15.000 10.500 N ZZZ3 n/a
7 TRCN0000376579 TCAAAGAACTTGGTCATAAAT pLKO_005 3499 3UTR 100% 15.000 10.500 N ZZZ3 n/a
8 TRCN0000365155 TCACCAATTAGAACCTATTTA pLKO_005 3074 CDS 100% 15.000 10.500 N ZZZ3 n/a
9 TRCN0000365154 ACCTCAAGAACATCGTTATAC pLKO_005 1586 CDS 100% 13.200 9.240 N ZZZ3 n/a
10 TRCN0000133663 GCACAGAAACTGACTTCTTTA pLKO.1 3592 3UTR 100% 13.200 9.240 N ZZZ3 n/a
11 TRCN0000133685 GCATCAGATGACGAAAGTATT pLKO.1 2802 CDS 100% 13.200 9.240 N ZZZ3 n/a
12 TRCN0000370279 GTAAGTCAATCTCCTACAAAT pLKO_005 1743 CDS 100% 13.200 9.240 N ZZZ3 n/a
13 TRCN0000134560 GTGCCAATTCAGAAAGGAAAT pLKO.1 645 CDS 100% 10.800 7.560 N ZZZ3 n/a
14 TRCN0000133791 CGATGTCTTATACTGGATGAT pLKO.1 969 CDS 100% 4.950 3.465 N ZZZ3 n/a
15 TRCN0000134559 GTTACAATTACCTTGACCCAA pLKO.1 3145 CDS 100% 2.640 1.848 N ZZZ3 n/a
16 TRCN0000353324 AGTGAGGAAGGGCCACTTAAT pLKO_005 1023 CDS 100% 13.200 7.920 N Zzz3 n/a
17 TRCN0000376637 AGTGAGGAAGGGCCACTTAAT pLKO_005 1023 CDS 100% 13.200 7.920 N ZZZ3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015534.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14102 pDONR223 100% 45% 43.9% None (many diffs) n/a
2 ccsbBroad304_14102 pLX_304 0% 45% 43.9% V5 (many diffs) n/a
3 TRCN0000467796 CCCCAAGCTGACCCAAAACTTGAA pLX_317 32.1% 45% 43.9% V5 (many diffs) n/a
Download CSV