Transcript: Mouse NM_015818.2

Mus musculus heparan sulfate 6-O-sulfotransferase 1 (Hs6st1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Hs6st1 (50785)
Length:
3732
CDS:
259..1494

Additional Resources:

NCBI RefSeq record:
NM_015818.2
NBCI Gene record:
Hs6st1 (50785)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015818.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103193 CATCCGGCCATTCATGCAATA pLKO.1 1194 CDS 100% 10.800 15.120 N Hs6st1 n/a
2 TRCN0000103192 CCGGCCATTCATGCAATACAA pLKO.1 1197 CDS 100% 5.625 7.875 N Hs6st1 n/a
3 TRCN0000103194 CATGAGCCATATCATTGAGAA pLKO.1 1467 CDS 100% 4.950 3.960 N Hs6st1 n/a
4 TRCN0000103190 CCCACCTATCAAAGCTGCTTT pLKO.1 1917 3UTR 100% 4.950 3.465 N Hs6st1 n/a
5 TRCN0000415657 GACGTTCAACCTCAAGTTCAT pLKO_005 1176 CDS 100% 4.950 3.465 N HS6ST1 n/a
6 TRCN0000103191 GCCCAGAAAGTTCTACTACAT pLKO.1 780 CDS 100% 4.950 3.465 N Hs6st1 n/a
7 TRCN0000036008 CGTGATCGTCTTCCTGCACAT pLKO.1 519 CDS 100% 4.050 2.835 N HS6ST1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015818.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07409 pDONR223 100% 91% 97.3% None (many diffs) n/a
2 ccsbBroad304_07409 pLX_304 0% 91% 97.3% V5 (many diffs) n/a
3 TRCN0000481249 CCCATCACGTCTCGATTCCGTTTG pLX_317 30% 91% 97.3% V5 (many diffs) n/a
4 ccsbBroadEn_11364 pDONR223 100% 88.6% 94.8% None (many diffs) n/a
5 ccsbBroad304_11364 pLX_304 0% 88.6% 94.8% V5 (many diffs) n/a
6 TRCN0000471834 GTATGAATAACCAATTCTACAACC pLX_317 31.8% 88.6% 94.8% V5 (many diffs) n/a
Download CSV