Transcript: Human NM_016145.4

Homo sapiens WD repeat domain 83 opposite strand (WDR83OS), mRNA.

Source:
NCBI, updated 2019-06-16
Taxon:
Homo sapiens (human)
Gene:
WDR83OS (51398)
Length:
619
CDS:
13..333

Additional Resources:

NCBI RefSeq record:
NM_016145.4
NBCI Gene record:
WDR83OS (51398)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016145.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143282 GAACAAAGTGCTGAGGTACAA pLKO.1 48 CDS 100% 4.950 6.930 N WDR83OS n/a
2 TRCN0000141399 CGAACAAAGTGCTGAGGTACA pLKO.1 47 CDS 100% 4.050 5.670 N WDR83OS n/a
3 TRCN0000122866 GCCGGACTACATGAACCTGCT pLKO.1 111 CDS 100% 0.720 1.008 N WDR83OS n/a
4 TRCN0000349667 GCCGGACTACATGAACCTGCT pLKO_005 111 CDS 100% 0.720 1.008 N WDR83OS n/a
5 TRCN0000143081 CGAAGCAAATGATGAGTAGCT pLKO.1 242 CDS 100% 2.640 2.112 N WDR83OS n/a
6 TRCN0000143986 CAAATGATGAGTAGCTTCATG pLKO.1 247 CDS 100% 4.950 3.465 N WDR83OS n/a
7 TRCN0000121852 GCAAATGATGAGTAGCTTCAT pLKO.1 246 CDS 100% 4.950 3.465 N WDR83OS n/a
8 TRCN0000319118 GCAAATGATGAGTAGCTTCAT pLKO_005 246 CDS 100% 4.950 3.465 N WDR83OS n/a
9 TRCN0000141826 GAGTAGCTTCATGCTGTCCAT pLKO.1 255 CDS 100% 2.640 1.848 N WDR83OS n/a
10 TRCN0000319055 GAGTAGCTTCATGCTGTCCAT pLKO_005 255 CDS 100% 2.640 1.848 N WDR83OS n/a
11 TRCN0000122392 GCCGAACAAAGTGCTGAGGTA pLKO.1 45 CDS 100% 2.640 1.848 N WDR83OS n/a
12 TRCN0000319117 GCCGAACAAAGTGCTGAGGTA pLKO_005 45 CDS 100% 2.640 1.848 N WDR83OS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016145.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03299 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03299 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469475 GGTGCAGACTGCTTGTCACCTAAT pLX_317 100% 100% 100% V5 n/a
Download CSV