Transcript: Human NM_016152.3

Homo sapiens retinoic acid receptor beta (RARB), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
RARB (5915)
Length:
2865
CDS:
449..1459

Additional Resources:

NCBI RefSeq record:
NM_016152.3
NBCI Gene record:
RARB (5915)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016152.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021194 CCGAGATAAGAACTGTGTTAT pLKO.1 466 CDS 100% 13.200 9.240 N RARB n/a
2 TRCN0000021196 GCCACCTCTCATTCAAGAAAT pLKO.1 1309 CDS 100% 13.200 9.240 N RARB n/a
3 TRCN0000427133 TCAGACGGCCTTACCCTAAAT pLKO_005 950 CDS 100% 13.200 9.240 N RARB n/a
4 TRCN0000222396 CCGCAGAAGTATTCAGAAGAA pLKO.1 427 5UTR 100% 4.950 3.465 N Rarb n/a
5 TRCN0000021195 CTGGGTAAATACACCACGAAT pLKO.1 704 CDS 100% 4.950 3.465 N RARB n/a
6 TRCN0000021198 GACATCCTGATTCTTAGAATT pLKO.1 890 CDS 100% 0.000 0.000 N RARB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016152.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01376 pDONR223 100% 75% 75% None 0_1ins336 n/a
2 ccsbBroad304_01376 pLX_304 0% 75% 75% V5 0_1ins336 n/a
3 TRCN0000469377 CGCATTGTATTTCGACTGGATGGT pLX_317 34% 75% 75% V5 0_1ins336 n/a
4 TRCN0000488589 TGGGTCACGGCAGAAACTACTCCC pLX_317 16.4% 74.9% 74.8% V5 0_1ins336;1008_1009insG n/a
Download CSV