Transcript: Human NM_016206.4

Homo sapiens vestigial like family member 3 (VGLL3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
VGLL3 (389136)
Length:
10438
CDS:
407..1387

Additional Resources:

NCBI RefSeq record:
NM_016206.4
NBCI Gene record:
VGLL3 (389136)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016206.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149029 GCAGAAGAAGTTAGCGGTATT pLKO.1 529 CDS 100% 10.800 15.120 N VGLL3 n/a
2 TRCN0000346384 TGCCGAGATGGAGTACCTTAA pLKO_005 640 CDS 100% 10.800 15.120 N Vgll3 n/a
3 TRCN0000376712 TGCCGAGATGGAGTACCTTAA pLKO_005 640 CDS 100% 10.800 15.120 N VGLL3 n/a
4 TRCN0000146645 CTTTCATGGAACAGTAGACAT pLKO.1 1297 CDS 100% 4.950 6.930 N VGLL3 n/a
5 TRCN0000365561 TTCATGGAACAGTAGACATAG pLKO_005 1299 CDS 100% 10.800 8.640 N VGLL3 n/a
6 TRCN0000365562 GAGTTAAGTTGCAGCATAAAT pLKO_005 1404 3UTR 100% 15.000 10.500 N VGLL3 n/a
7 TRCN0000370714 GTAGCTCTATGTGCATCTATT pLKO_005 1764 3UTR 100% 13.200 9.240 N VGLL3 n/a
8 TRCN0000414742 GAGTCCTGGCCTTATCCTTTG pLKO_005 1019 CDS 100% 6.000 4.200 N VGLL3 n/a
9 TRCN0000148617 CCCAAATACATGGAGCACAAA pLKO.1 3406 3UTR 100% 4.950 3.465 N VGLL3 n/a
10 TRCN0000147786 GCATCTTATTTGACCTGCTTA pLKO.1 9541 3UTR 100% 4.950 3.465 N VGLL3 n/a
11 TRCN0000147610 GAATAGTTTCCCAACTTCCTT pLKO.1 835 CDS 100% 3.000 2.100 N VGLL3 n/a
12 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 9021 3UTR 100% 1.080 0.540 Y GPR83 n/a
13 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 9021 3UTR 100% 1.080 0.540 Y MYORG n/a
14 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 5384 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016206.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14493 pDONR223 100% 97% 96% None (many diffs) n/a
2 ccsbBroad304_14493 pLX_304 0% 97% 96% V5 (many diffs) n/a
3 TRCN0000477775 ATGCACGCGCACGTTTCAGTCACG pLX_317 28.2% 97% 96% V5 (many diffs) n/a
Download CSV