Transcript: Human NM_016422.4

Homo sapiens ring finger protein 141 (RNF141), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
RNF141 (50862)
Length:
4049
CDS:
114..806

Additional Resources:

NCBI RefSeq record:
NM_016422.4
NBCI Gene record:
RNF141 (50862)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016422.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004177 GCTGGAATCTAAGGAGTATAT pLKO.1 1280 3UTR 100% 13.200 9.240 N RNF141 n/a
2 TRCN0000379328 AGTTGGTTATTAACAAGTTAC pLKO_005 142 CDS 100% 10.800 7.560 N Rnf141 n/a
3 TRCN0000004181 AGATGACTGGAGCAAATGAAT pLKO.1 694 CDS 100% 5.625 3.938 N RNF141 n/a
4 TRCN0000279768 AGATGACTGGAGCAAATGAAT pLKO_005 694 CDS 100% 5.625 3.938 N RNF141 n/a
5 TRCN0000004178 TGAAGATGATATGGCTAACTA pLKO.1 740 CDS 100% 5.625 3.938 N RNF141 n/a
6 TRCN0000279769 TGAAGATGATATGGCTAACTA pLKO_005 740 CDS 100% 5.625 3.938 N RNF141 n/a
7 TRCN0000004179 AGGAGGAGTGTTGTATCTGTA pLKO.1 568 CDS 100% 4.950 3.465 N RNF141 n/a
8 TRCN0000279839 AGGAGGAGTGTTGTATCTGTA pLKO_005 568 CDS 100% 4.950 3.465 N RNF141 n/a
9 TRCN0000004180 CATCTTGTCAGGCTAGTCTTT pLKO.1 517 CDS 100% 4.950 3.465 N RNF141 n/a
10 TRCN0000279770 CATCTTGTCAGGCTAGTCTTT pLKO_005 517 CDS 100% 4.950 3.465 N RNF141 n/a
11 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1766 3UTR 100% 4.950 2.475 Y CFLAR n/a
12 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1766 3UTR 100% 4.950 2.475 Y C19orf31 n/a
13 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1764 3UTR 100% 4.950 2.475 Y ERN2 n/a
14 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1764 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1764 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016422.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08190 pDONR223 100% 99.8% 100% None 117T>C n/a
2 ccsbBroad304_08190 pLX_304 0% 99.8% 100% V5 117T>C n/a
3 TRCN0000474540 TGGTGAACCTCGTGCATGCCCGTC pLX_317 70.7% 99.8% 100% V5 117T>C n/a
Download CSV