Transcript: Human NM_016426.7

Homo sapiens G2 and S-phase expressed 1 (GTSE1), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
GTSE1 (51512)
Length:
2983
CDS:
84..2303

Additional Resources:

NCBI RefSeq record:
NM_016426.7
NBCI Gene record:
GTSE1 (51512)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016426.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113879 CGGCGAGATTCCTGTCTAAAT pLKO.1 1434 CDS 100% 13.200 18.480 N GTSE1 n/a
2 TRCN0000290902 CGGCGAGATTCCTGTCTAAAT pLKO_005 1434 CDS 100% 13.200 18.480 N GTSE1 n/a
3 TRCN0000113877 GCCAGCTTGGAATTAAATAAT pLKO.1 282 CDS 100% 15.000 10.500 N GTSE1 n/a
4 TRCN0000290830 GCCAGCTTGGAATTAAATAAT pLKO_005 282 CDS 100% 15.000 10.500 N GTSE1 n/a
5 TRCN0000113878 GCCTACTCCTACAAATCAATT pLKO.1 1472 CDS 100% 13.200 9.240 N GTSE1 n/a
6 TRCN0000290900 GCCTACTCCTACAAATCAATT pLKO_005 1472 CDS 100% 13.200 9.240 N GTSE1 n/a
7 TRCN0000113880 GCCTCTGTCAAACATCAGCAA pLKO.1 1178 CDS 100% 2.640 1.848 N GTSE1 n/a
8 TRCN0000290831 GCCTCTGTCAAACATCAGCAA pLKO_005 1178 CDS 100% 2.640 1.848 N GTSE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016426.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11995 pDONR223 100% 97.3% 97.2% None 1_57del;1573T>C n/a
2 ccsbBroad304_11995 pLX_304 0% 97.3% 97.2% V5 1_57del;1573T>C n/a
3 TRCN0000467648 AGGTATGGGCTAAATGCAACGAAC pLX_317 20% 97.3% 97.2% V5 1_57del;1573T>C n/a
4 ccsbBroadEn_11994 pDONR223 100% 97.3% 97.1% None 1_57del;67C>T;1573T>C n/a
5 ccsbBroad304_11994 pLX_304 0% 97.3% 97.1% V5 1_57del;67C>T;1573T>C n/a
6 TRCN0000475379 CTCGCGACTGTCATGCACGGACCC pLX_317 23.4% 97.3% 97.1% V5 1_57del;67C>T;1573T>C n/a
Download CSV