Transcript: Human NM_016520.3

Homo sapiens chromosome 9 open reading frame 78 (C9orf78), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
C9orf78 (51759)
Length:
1795
CDS:
55..924

Additional Resources:

NCBI RefSeq record:
NM_016520.3
NBCI Gene record:
C9orf78 (51759)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016520.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263870 GACCTGGGCATCGATGCTAAA pLKO_005 583 CDS 100% 10.800 8.640 N C9orf78 n/a
2 TRCN0000263868 CTCAGAGGAGGTTCGATTAAA pLKO_005 123 CDS 100% 15.000 10.500 N C9orf78 n/a
3 TRCN0000263871 ATCGCCTTCCTCTCCCTATAT pLKO_005 948 3UTR 100% 13.200 9.240 N C9orf78 n/a
4 TRCN0000263867 CCAACATGGCTGTGAATTATG pLKO_005 698 CDS 100% 13.200 9.240 N C9orf78 n/a
5 TRCN0000263869 GGCAACTGATGACTATCATTA pLKO_005 870 CDS 100% 13.200 9.240 N C9orf78 n/a
6 TRCN0000167643 GCAGACATGATGAAGTACATT pLKO.1 391 CDS 100% 5.625 3.938 N C9orf78 n/a
7 TRCN0000167523 GTCTTTATGAACTTCCAGAAA pLKO.1 488 CDS 100% 4.950 3.465 N C9orf78 n/a
8 TRCN0000172754 CCAAAGAATGCAGAGGACTGT pLKO.1 469 CDS 100% 2.640 1.848 N C9orf78 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1013 3UTR 100% 13.200 6.600 Y LIAS n/a
10 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 1180 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016520.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03379 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03379 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473867 ATTATCTAGGGCGGATTGCCAAAT pLX_317 27.9% 100% 100% V5 n/a
4 ccsbBroadEn_15856 pDONR223 0% 99.6% 99.3% None 39C>T;415C>T;608A>G n/a
5 ccsbBroad304_15856 pLX_304 0% 99.6% 99.3% V5 39C>T;415C>T;608A>G n/a
6 TRCN0000472185 TAAAGCCGATCGTCAGATGGCCCT pLX_317 40.2% 99.6% 99.3% V5 39C>T;415C>T;608A>G n/a
Download CSV