Transcript: Human NM_016557.4

Homo sapiens atypical chemokine receptor 4 (ACKR4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ACKR4 (51554)
Length:
2310
CDS:
64..1116

Additional Resources:

NCBI RefSeq record:
NM_016557.4
NBCI Gene record:
ACKR4 (51554)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016557.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356762 TCCATGGTAGTGGCAATTTAT pLKO_005 241 CDS 100% 15.000 21.000 N ACKR4 n/a
2 TRCN0000008228 GATTTGTAGTACCCTTTCTTA pLKO.1 686 CDS 100% 5.625 4.500 N ACKR4 n/a
3 TRCN0000356760 AGAGCTTTGTGGTGATAATTT pLKO_005 1379 3UTR 100% 15.000 10.500 N ACKR4 n/a
4 TRCN0000356761 AGTTCTGCTCACAGTCGTTAT pLKO_005 783 CDS 100% 10.800 7.560 N ACKR4 n/a
5 TRCN0000008225 CCTCCCTGTATTCCTCACAAT pLKO.1 192 CDS 100% 4.950 3.465 N ACKR4 n/a
6 TRCN0000008227 GCACTTATGACTACAGTCAAT pLKO.1 122 CDS 100% 4.950 3.465 N ACKR4 n/a
7 TRCN0000008226 GCCTTATAACATTGTCAAGTT pLKO.1 825 CDS 100% 4.950 3.465 N ACKR4 n/a
8 TRCN0000008224 GCTGTAACGAAGAAGAGCTTT pLKO.1 1366 3UTR 100% 4.950 3.465 N ACKR4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016557.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03333 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03333 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477306 CTGACTAACTTATCCGAGTTTTAG pLX_317 41.1% 100% 100% V5 n/a
4 TRCN0000488482 ATGTTGGATAGAATCTTAACCTGA pLX_317 32.3% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000487760 CGTCTAAGTGAGGGTAGGCGTGAC pLX_317 27.7% 99.9% 99.7% V5 1050_1051insG n/a
Download CSV