Transcript: Mouse NM_016781.2

Mus musculus protein kinase, AMP-activated, gamma 1 non-catalytic subunit (Prkag1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Prkag1 (19082)
Length:
1680
CDS:
71..1063

Additional Resources:

NCBI RefSeq record:
NM_016781.2
NBCI Gene record:
Prkag1 (19082)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147362 GCAGCGATGAGACTTCATGA pXPR_003 AGG 94 9% 3 1.0886 Prkag1 PRKAG1 77747
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235978 CATCGCTGCTATGACCTAATT pLKO_005 173 CDS 100% 13.200 18.480 N Prkag1 n/a
2 TRCN0000235979 TTGTGCTCCTCGGGTAGATTC pLKO_005 1320 3UTR 100% 10.800 15.120 N Prkag1 n/a
3 TRCN0000235980 GTTCCAAGTTGGTGGTATTTG pLKO_005 201 CDS 100% 13.200 10.560 N Prkag1 n/a
4 TRCN0000235981 AGCATCGGTCCCACTACTTTG pLKO_005 867 CDS 100% 10.800 8.640 N Prkag1 n/a
5 TRCN0000235977 CAAGTTTGATGTGATCAATTT pLKO_005 793 CDS 100% 13.200 9.240 N Prkag1 n/a
6 TRCN0000025116 GCTCTAGAGAATGAACACTTT pLKO.1 101 CDS 100% 4.950 3.465 N Prkag1 n/a
7 TRCN0000025118 CTGTCTGACATCTTACAGGAT pLKO.1 1010 CDS 100% 2.640 2.112 N Prkag1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01279 pDONR223 100% 87.5% 97.2% None (many diffs) n/a
2 ccsbBroad304_01279 pLX_304 0% 87.5% 97.2% V5 (many diffs) n/a
3 TRCN0000469241 CGTTTCCAGAGTTCACATCTGGTT pLX_317 39.8% 87.5% 97.2% V5 (many diffs) n/a
4 ccsbBroadEn_14783 pDONR223 0% 87.5% 97.2% None (many diffs) n/a
5 ccsbBroad304_14783 pLX_304 0% 87.5% 97.2% V5 (many diffs) n/a
6 TRCN0000473792 TGATCGGGTGAATCCCGAGTAAAG pLX_317 51.5% 87.5% 97.2% V5 (many diffs) n/a
Download CSV