Transcript: Human NM_016830.4

Homo sapiens vesicle associated membrane protein 1 (VAMP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
VAMP1 (6843)
Length:
1092
CDS:
147..497

Additional Resources:

NCBI RefSeq record:
NM_016830.4
NBCI Gene record:
VAMP1 (6843)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016830.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151479 CCAAGCTAAAGAGGAAGTATT pLKO.1 397 CDS 100% 13.200 9.240 N VAMP1 n/a
2 TRCN0000219759 GCAGGCAGGAGCATCACAATT pLKO.1 362 CDS 100% 13.200 9.240 N VAMP1 n/a
3 TRCN0000219760 TGCCATCATCGTGGTAGTTAT pLKO.1 461 CDS 100% 13.200 9.240 N VAMP1 n/a
4 TRCN0000245377 CCTCCTAACATGACCAGTAAC pLKO_005 219 CDS 100% 10.800 7.560 N VAMP1 n/a
5 TRCN0000380882 GAGCAGTGCTGCCAAGCTAAA pLKO_005 386 CDS 100% 10.800 7.560 N Vamp1 n/a
6 TRCN0000179134 GCCAAGCTAAAGAGGAAGTAT pLKO.1 396 CDS 100% 5.625 3.938 N VAMP1 n/a
7 TRCN0000155272 GCTGGAAGAAAGCAGTCAGTA pLKO.1 501 3UTR 100% 4.950 3.465 N VAMP1 n/a
8 TRCN0000240460 GGTGGACATCATACGTGTGAA pLKO_005 278 CDS 100% 4.950 3.465 N VAMP1 n/a
9 TRCN0000240459 ACTGCAAGATGATGATCATGC pLKO_005 427 CDS 100% 4.050 2.835 N VAMP1 n/a
10 TRCN0000240462 TACAGCAAACCCAGGCACAAG pLKO_005 247 CDS 100% 4.050 2.835 N VAMP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016830.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07022 pDONR223 100% 96% 96.5% None 252C>A;341_342insTAAGTATC;344_348delGGGAC n/a
2 ccsbBroad304_07022 pLX_304 0% 96% 96.5% V5 252C>A;341_342insTAAGTATC;344_348delGGGAC n/a
3 TRCN0000475028 GTTAGAAAACAATAGATGGTGTGA pLX_317 93.8% 96% 96.5% V5 252C>A;341_342insTAAGTATC;344_348delGGGAC n/a
Download CSV