Transcript: Mouse NM_016891.3

Mus musculus protein phosphatase 2, regulatory subunit A, alpha (Ppp2r1a), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ppp2r1a (51792)
Length:
2256
CDS:
53..1822

Additional Resources:

NCBI RefSeq record:
NM_016891.3
NBCI Gene record:
Ppp2r1a (51792)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016891.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218278 GATAGGACCCATTCTTGATAA pLKO_005 1690 CDS 100% 13.200 18.480 N Ppp2r1a n/a
2 TRCN0000012624 GCACCGAATGACTACACTCTT pLKO.1 1540 CDS 100% 4.950 6.930 N Ppp2r1a n/a
3 TRCN0000012627 CTATCCTATTGCGGTGCTCAT pLKO.1 82 CDS 100% 4.050 5.670 N Ppp2r1a n/a
4 TRCN0000012625 GCTGGGAACCTTCACAACTTT pLKO.1 268 CDS 100% 5.625 4.500 N Ppp2r1a n/a
5 TRCN0000226218 ACGTTCAGCTTCGTCTCAATA pLKO_005 123 CDS 100% 13.200 9.240 N Ppp2r1a n/a
6 TRCN0000226219 ATGTCAAGAGTGAGATCATTC pLKO_005 651 CDS 100% 10.800 7.560 N Ppp2r1a n/a
7 TRCN0000226220 ATGTGGATGTCAAGTACTTTG pLKO_005 1767 CDS 100% 10.800 7.560 N Ppp2r1a n/a
8 TRCN0000231509 TTGCCAATGTCCGCTTCAATG pLKO_005 1650 CDS 100% 10.800 7.560 N PPP2R1A n/a
9 TRCN0000012626 GCCACCAGCAACCTTAAGAAA pLKO.1 1436 CDS 100% 5.625 3.938 N Ppp2r1a n/a
10 TRCN0000226221 GGTTGTTCCTGCCCATATTGG pLKO_005 2063 3UTR 100% 4.950 3.465 N Ppp2r1a n/a
11 TRCN0000012623 CCCACAAAGTTACCTCCCTTA pLKO.1 1870 3UTR 100% 4.050 2.835 N Ppp2r1a n/a
12 TRCN0000380757 CCTTCCAGAACCTGATGAAAG pLKO_005 909 CDS 100% 10.800 7.560 N PPP2R1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016891.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01263 pDONR223 100% 90.5% 99.8% None (many diffs) n/a
2 ccsbBroad304_01263 pLX_304 0% 90.5% 99.8% V5 (many diffs) n/a
3 TRCN0000471418 CGAGTTAATCTGGCAATCTATCTT pLX_317 27.3% 90.5% 99.8% V5 (many diffs) n/a
Download CSV