Transcript: Mouse NM_016917.2

Mus musculus solute carrier family 40 (iron-regulated transporter), member 1 (Slc40a1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Slc40a1 (53945)
Length:
3380
CDS:
332..2044

Additional Resources:

NCBI RefSeq record:
NM_016917.2
NBCI Gene record:
Slc40a1 (53945)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079798 CCTCCATGTATGAAGGTTATA pLKO.1 2489 3UTR 100% 13.200 18.480 N Slc40a1 n/a
2 TRCN0000079799 CGGTTGGAATTTGGTGTCCAT pLKO.1 958 CDS 100% 2.640 3.696 N Slc40a1 n/a
3 TRCN0000319587 GTCGGCCAGATTATGACATTT pLKO_005 905 CDS 100% 13.200 10.560 N Slc40a1 n/a
4 TRCN0000319651 TCGCCAGCAAAGATGGTTATT pLKO_005 2187 3UTR 100% 13.200 10.560 N Slc40a1 n/a
5 TRCN0000319650 GTGGATCCATCCTTAGTATTT pLKO_005 1344 CDS 100% 13.200 9.240 N Slc40a1 n/a
6 TRCN0000079800 CAGACATGAATGCTACCATTA pLKO.1 843 CDS 100% 10.800 7.560 N Slc40a1 n/a
7 TRCN0000349524 CAGACATGAATGCTACCATTA pLKO_005 843 CDS 100% 10.800 7.560 N Slc40a1 n/a
8 TRCN0000079801 GCAATGGGACATCTTATGTAT pLKO.1 1922 CDS 100% 5.625 3.938 N Slc40a1 n/a
9 TRCN0000317773 GCAATGGGACATCTTATGTAT pLKO_005 1922 CDS 100% 5.625 3.938 N Slc40a1 n/a
10 TRCN0000079802 CCTGATCATCACTATTGCAAA pLKO.1 733 CDS 100% 4.950 3.465 N Slc40a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016917.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08161 pDONR223 100% 86.5% 90% None (many diffs) n/a
2 ccsbBroad304_08161 pLX_304 0% 86.5% 90% V5 (many diffs) n/a
3 ccsbBroadEn_14128 pDONR223 100% 86.4% 89.8% None (many diffs) n/a
4 TRCN0000466510 AACAGGGACGATGTAACGGTATTA pLX_317 18.4% 86.4% 89.8% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV