Transcript: Human NM_016950.2

Homo sapiens SPARC (osteonectin), cwcv and kazal like domains proteoglycan 3 (SPOCK3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-17
Taxon:
Homo sapiens (human)
Gene:
SPOCK3 (50859)
Length:
2989
CDS:
142..1452

Additional Resources:

NCBI RefSeq record:
NM_016950.2
NBCI Gene record:
SPOCK3 (50859)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373574 ATGAAATGTAGTCGCCATAAA pLKO_005 418 CDS 100% 13.200 10.560 N SPOCK3 n/a
2 TRCN0000373575 ACGAAGTAGAGGATGATTATT pLKO_005 329 CDS 100% 15.000 10.500 N SPOCK3 n/a
3 TRCN0000446129 ACGAAGTAGAGGATGATTATT pLKO_005 329 CDS 100% 15.000 10.500 N Spock3 n/a
4 TRCN0000053621 AGGATGATGAAGACGATATTA pLKO.1 1346 CDS 100% 15.000 10.500 N SPOCK3 n/a
5 TRCN0000373650 GATTCTAAACCTCACATATAT pLKO_005 1545 3UTR 100% 15.000 10.500 N SPOCK3 n/a
6 TRCN0000053622 CCAGTACAAGCAGAAATGTTA pLKO.1 713 CDS 100% 5.625 3.938 N SPOCK3 n/a
7 TRCN0000053618 CCCTTCGATCAGGCTTTAGAT pLKO.1 373 CDS 100% 5.625 3.938 N SPOCK3 n/a
8 TRCN0000053619 GCTCACCACAATCTCTCAGTA pLKO.1 273 CDS 100% 4.950 3.465 N SPOCK3 n/a
9 TRCN0000053620 CGATACCAGCATCTTGCCAAT pLKO.1 864 CDS 100% 4.050 2.835 N SPOCK3 n/a
10 TRCN0000080270 GCAAACTAGAATATCAGGCAT pLKO.1 626 CDS 100% 2.640 1.848 N Spock3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03159 pDONR223 100% 99.3% 99.3% None 190_198delGAAGTAGAG n/a
2 ccsbBroad304_03159 pLX_304 0% 99.3% 99.3% V5 190_198delGAAGTAGAG n/a
3 TRCN0000466713 CAGATAGTCCCGAGAGCACTGCGA pLX_317 36.7% 99.3% 99.3% V5 190_198delGAAGTAGAG n/a
4 ccsbBroadEn_15815 pDONR223 0% 99.2% 99.3% None 147T>C;190_198delGAAGTAGAG n/a
5 ccsbBroad304_15815 pLX_304 0% 99.2% 99.3% V5 147T>C;190_198delGAAGTAGAG n/a
6 TRCN0000465485 AAACATGAGATCAGGTGTTCACAT pLX_317 30.6% 99.2% 99.3% V5 147T>C;190_198delGAAGTAGAG n/a
Download CSV