Transcript: Human NM_017449.4

Homo sapiens EPH receptor B2 (EPHB2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
EPHB2 (2048)
Length:
11054
CDS:
146..3106

Additional Resources:

NCBI RefSeq record:
NM_017449.4
NBCI Gene record:
EPHB2 (2048)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147792 CTTGCGGTAGAAGACACGCA pXPR_003 CGG 571 19% 3 0.9551 EPHB2 EPHB2 77547
2 BRDN0001147198 AGGTCACTGATGTAAATGCG pXPR_003 TGG 1176 40% 5 0.651 EPHB2 EPHB2 77548
3 BRDN0001147469 AAGCTGCAACACTACACCAG pXPR_003 TGG 1754 59% 9 0.3655 EPHB2 EPHB2 77546
4 BRDN0001146273 ACCAAGTTTATCCGGCGCCG pXPR_003 TGG 239 8% 3 -0.5171 EPHB2 EPHB2 77545
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017449.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413853 ACGCTTTCTAGAGGACGATAC pLKO_005 2449 CDS 100% 6.000 8.400 N EPHB2 n/a
2 TRCN0000006423 GCTAGACAAGATGATCCGCAA pLKO.1 2782 CDS 100% 2.160 3.024 N EPHB2 n/a
3 TRCN0000199079 CCATCGGCAGTGTCCATCATG pLKO.1 1451 CDS 100% 1.650 2.310 N EPHB2 n/a
4 TRCN0000425463 GCGGGAAATACAAGGAATATT pLKO_005 3334 3UTR 100% 15.000 12.000 N EPHB2 n/a
5 TRCN0000006425 CGTGTTTGAGTCAAGCCAGAA pLKO.1 334 CDS 100% 4.050 3.240 N EPHB2 n/a
6 TRCN0000199819 GCGTGTCTTCTACCGCAAGTG pLKO.1 715 CDS 100% 1.350 1.080 N EPHB2 n/a
7 TRCN0000436520 AGATGATGATGGAGGACATTC pLKO_005 2985 CDS 100% 10.800 7.560 N EPHB2 n/a
8 TRCN0000432938 TTTAAAGAGGATTCTCATAAG pLKO_005 3356 3UTR 100% 10.800 7.560 N EPHB2 n/a
9 TRCN0000006422 CCCGGATCATTCACTGTGATA pLKO.1 4592 3UTR 100% 4.950 3.465 N EPHB2 n/a
10 TRCN0000196573 GAAGATCTACATCGATCCTTT pLKO.1 1924 CDS 100% 4.950 3.465 N EPHB2 n/a
11 TRCN0000199673 GCGCAGATGAACCAGATTCAG pLKO.1 3071 CDS 100% 4.950 3.465 N EPHB2 n/a
12 TRCN0000023308 CCTGAACAGTATCCAGGTGAT pLKO.1 3046 CDS 100% 4.050 2.835 N Ephb2 n/a
13 TRCN0000006426 CGGGAGTTTGCCAAGGAAATT pLKO.1 1973 CDS 100% 13.200 7.920 N EPHB2 n/a
14 TRCN0000419886 CCCATCAAGCTCTACTGTAAC pLKO_005 851 CDS 100% 10.800 6.480 N EPHB2 n/a
15 TRCN0000415081 GACCTTCAACCTCTATTACTA pLKO_005 472 CDS 100% 5.625 3.375 N EPHB2 n/a
16 TRCN0000006424 GCTGTGATTTCCAGTGTCAAT pLKO.1 1133 CDS 100% 4.950 2.970 N EPHB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017449.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487826 CAGTTAACCTTGTCTCTGTAGCCA pLX_317 9.4% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000488948 GCCAACGTGAGACAAAAACCATAA pLX_317 12.7% 99.9% 99.8% V5 2958_2959insG n/a
3 ccsbBroadEn_10804 pDONR223 100% 48.5% 48.2% None (many diffs) n/a
4 ccsbBroad304_10804 pLX_304 0% 48.5% 48.2% V5 (many diffs) n/a
5 TRCN0000468595 AGGACCGTGTTACCCAGCCCCAGT pLX_317 25.8% 48.5% 48.2% V5 (many diffs) n/a
Download CSV