Transcript: Human NM_017645.5

Homo sapiens HAUS augmin like complex subunit 6 (HAUS6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
HAUS6 (54801)
Length:
6323
CDS:
254..3121

Additional Resources:

NCBI RefSeq record:
NM_017645.5
NBCI Gene record:
HAUS6 (54801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017645.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149574 GCAGGTACGTTGTTGCATATA pLKO.1 4768 3UTR 100% 13.200 18.480 N HAUS6 n/a
2 TRCN0000129435 GCAAGATTGACGGTAGACCTT pLKO.1 1235 CDS 100% 2.640 3.696 N HAUS6 n/a
3 TRCN0000128606 CCAATTCAAATGGATGCTGAA pLKO.1 2081 CDS 100% 4.050 3.240 N HAUS6 n/a
4 TRCN0000275942 GGTCTCTTTCACCACTAATTA pLKO_005 2967 CDS 100% 15.000 10.500 N HAUS6 n/a
5 TRCN0000275878 GAGTAATCTTGTAAGCATTAA pLKO_005 3387 3UTR 100% 13.200 9.240 N HAUS6 n/a
6 TRCN0000149700 GCCAGAATCATTACCTGTGTT pLKO.1 2116 CDS 100% 4.950 3.465 N HAUS6 n/a
7 TRCN0000275877 GCCAGAATCATTACCTGTGTT pLKO_005 2116 CDS 100% 4.950 3.465 N HAUS6 n/a
8 TRCN0000149888 GCTTTCAGAAACTAGCCGAAT pLKO.1 2365 CDS 100% 4.050 2.835 N HAUS6 n/a
9 TRCN0000275875 GCTTTCAGAAACTAGCCGAAT pLKO_005 2365 CDS 100% 4.050 2.835 N HAUS6 n/a
10 TRCN0000128439 GCACATAAGCAACATAACCAA pLKO.1 1550 CDS 100% 3.000 2.100 N HAUS6 n/a
11 TRCN0000275940 ATTTGCATACTGAGCATATAA pLKO_005 2910 CDS 100% 15.000 9.000 N HAUS6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017645.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15870 pDONR223 0% 36.9% 36.8% None 1_1803del;1844C>T;2282G>T n/a
2 ccsbBroad304_15870 pLX_304 0% 36.9% 36.8% V5 1_1803del;1844C>T;2282G>T n/a
3 TRCN0000473199 AAAGGCCTTTTCGCACGCCTTGTC pLX_317 40.5% 36.9% 36.8% V5 1_1803del;1844C>T;2282G>T n/a
Download CSV