Transcript: Human NM_017662.5

Homo sapiens transient receptor potential cation channel subfamily M member 6 (TRPM6), transcript variant a, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TRPM6 (140803)
Length:
8252
CDS:
66..6134

Additional Resources:

NCBI RefSeq record:
NM_017662.5
NBCI Gene record:
TRPM6 (140803)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017662.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199953 GCGGCAATGATCCAGGTATTG pLKO.1 5355 CDS 100% 10.800 15.120 N TRPM6 n/a
2 TRCN0000199682 GCGGGAAATTTGGGTGATTTG pLKO.1 8001 3UTR 100% 10.800 15.120 N TRPM6 n/a
3 TRCN0000021587 CCAAATTCTAATGGAGTGTAT pLKO.1 1163 CDS 100% 4.950 6.930 N TRPM6 n/a
4 TRCN0000199969 CCTCATTGGTAGAGCATATCG pLKO.1 1622 CDS 100% 4.950 6.930 N TRPM6 n/a
5 TRCN0000021588 GCTCCCTATCTGATAACTCAA pLKO.1 4555 CDS 100% 4.950 6.930 N TRPM6 n/a
6 TRCN0000021585 CCCTCTAATCTAAAGCGAGTT pLKO.1 4107 CDS 100% 4.050 5.670 N TRPM6 n/a
7 TRCN0000196800 GACAGATCCATCTGTTATAAA pLKO.1 5858 CDS 100% 1.500 2.100 N TRPM6 n/a
8 TRCN0000197023 GAGTTCCACAAGGGCTAATTT pLKO.1 7945 3UTR 100% 15.000 12.000 N TRPM6 n/a
9 TRCN0000021584 CCTGGCATAAAGAATGTATAT pLKO.1 7494 3UTR 100% 13.200 9.240 N TRPM6 n/a
10 TRCN0000021586 CCGGAAGTATAACAACAACAA pLKO.1 5714 CDS 100% 4.950 3.465 N TRPM6 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7184 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7184 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017662.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.