Transcript: Human NM_017774.3

Homo sapiens CDK5 regulatory subunit associated protein 1 like 1 (CDKAL1), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
CDKAL1 (54901)
Length:
3272
CDS:
168..1907

Additional Resources:

NCBI RefSeq record:
NM_017774.3
NBCI Gene record:
CDKAL1 (54901)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017774.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364374 ATGACAAATCCGCCCTATATT pLKO_005 1041 CDS 100% 15.000 21.000 N CDKAL1 n/a
2 TRCN0000056646 CGAAGGTACGAAGGCGAAATA pLKO.1 274 CDS 100% 13.200 18.480 N CDKAL1 n/a
3 TRCN0000364306 CCGAAGGTACGAAGGCGAAAT pLKO_005 273 CDS 100% 10.800 15.120 N CDKAL1 n/a
4 TRCN0000056643 GCATGACAAATCCGCCCTATA pLKO.1 1039 CDS 100% 10.800 15.120 N CDKAL1 n/a
5 TRCN0000256110 CTAGCTGCTTATGGCTATAAA pLKO_005 426 CDS 100% 15.000 12.000 N CDKAL1 n/a
6 TRCN0000364304 GATTGGATTTGCCGAAGATTA pLKO_005 745 CDS 100% 13.200 10.560 N CDKAL1 n/a
7 TRCN0000364371 GGGCTTATGGCAGAGATATTG pLKO_005 949 CDS 100% 13.200 10.560 N CDKAL1 n/a
8 TRCN0000056645 CGATTGGATTTGCCGAAGATT pLKO.1 744 CDS 100% 5.625 4.500 N CDKAL1 n/a
9 TRCN0000256111 AGTTGTGGAGGAGACAATTAA pLKO_005 662 CDS 100% 15.000 10.500 N CDKAL1 n/a
10 TRCN0000256112 ATGCATCCGATGCAGATTTAT pLKO_005 457 CDS 100% 15.000 10.500 N CDKAL1 n/a
11 TRCN0000364368 ACCATAGCACATCCTTCAAAT pLKO_005 2115 3UTR 100% 13.200 9.240 N CDKAL1 n/a
12 TRCN0000256113 ACTATTGCTACAGATATTATC pLKO_005 1236 CDS 100% 13.200 9.240 N CDKAL1 n/a
13 TRCN0000364305 AGCCTGTTTATTAACCAATTT pLKO_005 1329 CDS 100% 13.200 9.240 N CDKAL1 n/a
14 TRCN0000056644 CCTGAACAGTTGCACTGTAAA pLKO.1 482 CDS 100% 13.200 9.240 N CDKAL1 n/a
15 TRCN0000364369 CTAATGGAAACATCTATAAAG pLKO_005 1915 3UTR 100% 13.200 9.240 N CDKAL1 n/a
16 TRCN0000364303 CTATGAATCAGGCAAACATTT pLKO_005 1604 CDS 100% 13.200 9.240 N CDKAL1 n/a
17 TRCN0000256114 GACCACTTTAGAAACTCAATT pLKO_005 516 CDS 100% 13.200 9.240 N CDKAL1 n/a
18 TRCN0000256115 TTATGTTGCACACAATCAATT pLKO_005 1520 CDS 100% 13.200 9.240 N CDKAL1 n/a
19 TRCN0000265738 ATTTGGCCAGTTATCCAATTG pLKO_005 853 CDS 100% 10.800 7.560 N CDKAL1 n/a
20 TRCN0000265747 CCATTGGTTATTTGACCTAAA pLKO_005 2080 3UTR 100% 10.800 7.560 N CDKAL1 n/a
21 TRCN0000265766 TTAAGGGACTGAGTATCATTG pLKO_005 613 CDS 100% 10.800 7.560 N CDKAL1 n/a
22 TRCN0000056647 GACATCTATGAATCAGGCAAA pLKO.1 1599 CDS 100% 4.050 2.835 N CDKAL1 n/a
23 TRCN0000256116 CCATTCTCCAAGGGCAATAAT pLKO_005 1985 3UTR 100% 15.000 9.000 N CDKAL1 n/a
24 TRCN0000364367 ACTTGTTGAAGAGTACAAATT pLKO_005 1304 CDS 100% 13.200 7.920 N CDKAL1 n/a
25 TRCN0000194337 CCACCAAGTGACAGCACTATT pLKO.1 327 CDS 100% 13.200 7.920 N Cdkal1 n/a
26 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 2551 3UTR 100% 10.800 5.400 Y MRPS16 n/a
27 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2517 3UTR 100% 4.950 2.475 Y LOC387873 n/a
28 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 2551 3UTR 100% 10.800 5.400 Y CD3EAP n/a
29 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3132 3UTR 100% 5.625 2.813 Y KLHL30 n/a
30 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3132 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017774.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03477 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03477 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475115 ACTTGGTCCAGACCCATGATCACA pLX_317 30.9% 100% 100% V5 n/a
4 ccsbBroadEn_14174 pDONR223 100% 16.3% 1.5% None 14_17delCCTG;285_286insGGT;289_1737del n/a
5 ccsbBroad304_14174 pLX_304 0% 16.3% 1.5% V5 (not translated due to prior stop codon) 14_17delCCTG;285_286insGGT;289_1737del n/a
6 TRCN0000468296 GAAAAGTAAGGACTTAGACTTGGT pLX_317 100% 16.3% 1.5% V5 (not translated due to prior stop codon) 14_17delCCTG;285_286insGGT;289_1737del n/a
Download CSV