Transcript: Human NM_018227.6

Homo sapiens ubiquitin like modifier activating enzyme 6 (UBA6), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
UBA6 (55236)
Length:
9540
CDS:
37..3195

Additional Resources:

NCBI RefSeq record:
NM_018227.6
NBCI Gene record:
UBA6 (55236)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018227.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432031 ATAACGGTGATATCGCCATTT pLKO_005 823 CDS 100% 10.800 15.120 N UBA6 n/a
2 TRCN0000007709 GCAGATATTGTTGAATCACTA pLKO.1 1300 CDS 100% 4.950 3.960 N UBA6 n/a
3 TRCN0000425327 CCATTCCAATTGTAGTATTTA pLKO_005 2822 CDS 100% 15.000 10.500 N UBA6 n/a
4 TRCN0000431484 GTGGATGAAGGGTGGATATTT pLKO_005 3695 3UTR 100% 15.000 10.500 N UBA6 n/a
5 TRCN0000425554 ACAGGTTTAAATGGATCTATA pLKO_005 796 CDS 100% 13.200 9.240 N UBA6 n/a
6 TRCN0000433288 AGGCATAGCTGTCCAAGTTAA pLKO_005 891 CDS 100% 13.200 9.240 N UBA6 n/a
7 TRCN0000007710 CCATTGCAGAAGAAGATCAAT pLKO.1 529 CDS 100% 5.625 3.938 N UBA6 n/a
8 TRCN0000007707 GCTCTTAGAGAATCCGTGAAT pLKO.1 3896 3UTR 100% 4.950 3.465 N UBA6 n/a
9 TRCN0000416677 ACAGAACTGGAACCATATTTA pLKO_005 865 CDS 100% 15.000 9.000 N UBA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018227.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12188 pDONR223 100% 36.3% 35% None (many diffs) n/a
2 ccsbBroad304_12188 pLX_304 0% 36.3% 35% V5 (many diffs) n/a
3 TRCN0000472225 CACTTCCGCTATCCATCCCTAAAG pLX_317 42.1% 36.3% 35% V5 (many diffs) n/a
Download CSV