Transcript: Human NM_018244.5

Homo sapiens ubiquinol-cytochrome c reductase complex assembly factor 1 (UQCC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
UQCC1 (55245)
Length:
2267
CDS:
11..910

Additional Resources:

NCBI RefSeq record:
NM_018244.5
NBCI Gene record:
UQCC1 (55245)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018244.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148979 GATGTGTCTAGTCCGAATGAA pLKO.1 475 CDS 100% 5.625 7.875 N UQCC1 n/a
2 TRCN0000232946 ACCGCTTCTCTCAGTTTATTT pLKO_005 2049 3UTR 100% 15.000 10.500 N UQCC1 n/a
3 TRCN0000232944 GTGTCGTATCATAGTTCATTT pLKO_005 523 CDS 100% 13.200 9.240 N UQCC1 n/a
4 TRCN0000232943 AGATTCCTGGAATAGACATAC pLKO_005 183 CDS 100% 10.800 7.560 N UQCC1 n/a
5 TRCN0000232945 GAACCTTCTTCAACCGGAAAT pLKO_005 705 CDS 100% 10.800 7.560 N UQCC1 n/a
6 TRCN0000148028 GAGTATGTGAGGAAACAGATA pLKO.1 758 CDS 100% 4.950 3.465 N UQCC1 n/a
7 TRCN0000146460 CCTTCTTTATTCCAGGGACTT pLKO.1 1399 3UTR 100% 4.050 2.835 N UQCC1 n/a
8 TRCN0000148671 CGACATCTTGAATTGCTGGTA pLKO.1 737 CDS 100% 2.640 1.848 N UQCC1 n/a
9 TRCN0000149717 GATTGATACCTGTGTCTCCTA pLKO.1 78 CDS 100% 2.640 1.848 N UQCC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018244.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08495 pDONR223 100% 99.8% 99.6% None 152G>A n/a
2 ccsbBroad304_08495 pLX_304 0% 99.8% 99.6% V5 152G>A n/a
3 TRCN0000480068 AGGCTCTTTTCCCGTCTAAGCATA pLX_317 19.1% 99.8% 99.6% V5 152G>A n/a
4 ccsbBroadEn_12190 pDONR223 100% 62.5% 54.9% None 1_59del;130_406del n/a
5 ccsbBroad304_12190 pLX_304 0% 62.5% 54.9% V5 1_59del;130_406del n/a
6 TRCN0000471610 TAACATAAATCCCCGACTCTAGGC pLX_317 64.7% 62.5% 54.9% V5 1_59del;130_406del n/a
Download CSV