Transcript: Human NM_018590.5

Homo sapiens chondroitin sulfate N-acetylgalactosaminyltransferase 2 (CSGALNACT2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CSGALNACT2 (55454)
Length:
3765
CDS:
377..2005

Additional Resources:

NCBI RefSeq record:
NM_018590.5
NBCI Gene record:
CSGALNACT2 (55454)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018590.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295792 TAATCGTGGACGAGGACTAAA pLKO_005 1405 CDS 100% 13.200 18.480 N Csgalnact2 n/a
2 TRCN0000154970 GCATAGGCTATCAGAGCAACA pLKO.1 693 CDS 100% 4.050 5.670 N CSGALNACT2 n/a
3 TRCN0000151456 CGTTACTGTATGAACCACAAA pLKO.1 2020 3UTR 100% 4.950 3.960 N CSGALNACT2 n/a
4 TRCN0000319332 CGTTACTGTATGAACCACAAA pLKO_005 2020 3UTR 100% 4.950 3.960 N CSGALNACT2 n/a
5 TRCN0000151672 GCTGAAAGAACTGAAGCATTT pLKO.1 1211 CDS 100% 10.800 7.560 N CSGALNACT2 n/a
6 TRCN0000319331 GCTGAAAGAACTGAAGCATTT pLKO_005 1211 CDS 100% 10.800 7.560 N CSGALNACT2 n/a
7 TRCN0000150897 GTGGTGTTCAGTCTTTACAAT pLKO.1 1556 CDS 100% 5.625 3.938 N CSGALNACT2 n/a
8 TRCN0000152477 CGAGATGAATTGGTGGAAGTT pLKO.1 905 CDS 100% 4.950 3.465 N CSGALNACT2 n/a
9 TRCN0000319330 CGAGATGAATTGGTGGAAGTT pLKO_005 905 CDS 100% 4.950 3.465 N CSGALNACT2 n/a
10 TRCN0000155785 CCCAGACTGATGGAAATGCAT pLKO.1 483 CDS 100% 3.000 2.100 N CSGALNACT2 n/a
11 TRCN0000153384 GAGTATTATCAAGCCCTCCTA pLKO.1 539 CDS 100% 2.640 1.848 N CSGALNACT2 n/a
12 TRCN0000319329 GAGTATTATCAAGCCCTCCTA pLKO_005 539 CDS 100% 2.640 1.848 N CSGALNACT2 n/a
13 TRCN0000183177 GTGGAGAAGATGTTCATCTTT pLKO.1 1743 CDS 100% 0.563 0.394 N LOC286453 n/a
14 TRCN0000151072 GCATCTTCATAAACAGGCATA pLKO.1 1957 CDS 100% 4.050 2.430 N CSGALNACT2 n/a
15 TRCN0000179517 GCATCCAGTCTAAAGCCATAA pLKO.1 1881 CDS 100% 10.800 7.560 N LOC286453 n/a
16 TRCN0000110462 CCCAGACTGATGGAAATGCTT pLKO.1 483 CDS 100% 3.000 2.100 N Csgalnact2 n/a
17 TRCN0000288553 CCCAGACTGATGGAAATGCTT pLKO_005 483 CDS 100% 3.000 2.100 N Csgalnact2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018590.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08535 pDONR223 100% 99.9% 100% None 18G>T n/a
2 ccsbBroad304_08535 pLX_304 0% 99.9% 100% V5 18G>T n/a
3 TRCN0000469973 TCAAATCCGGCAATCTTTTCTCTC pLX_317 27.8% 99.9% 100% V5 18G>T n/a
Download CSV