Transcript: Human NM_018899.6

Homo sapiens protocadherin alpha subfamily C, 2 (PCDHAC2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
PCDHAC2 (56134)
Length:
5725
CDS:
292..3315

Additional Resources:

NCBI RefSeq record:
NM_018899.6
NBCI Gene record:
PCDHAC2 (56134)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018899.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055528 CCTCGGACATACTCTGAAATT pLKO.1 2383 CDS 100% 13.200 18.480 N PCDHAC2 n/a
2 TRCN0000055530 GCGTACACTGAAGGTTGAGAT pLKO.1 1647 CDS 100% 4.950 6.930 N PCDHAC2 n/a
3 TRCN0000055529 CCGACTGAATGGCTTTGGAAA pLKO.1 1521 CDS 100% 4.950 3.465 N PCDHAC2 n/a
4 TRCN0000055531 GCTTCTGTGGAGTAAGGGAAA pLKO.1 2522 CDS 100% 4.050 2.835 N PCDHAC2 n/a
5 TRCN0000055532 GCTGTCAACTCCTTTGACTAT pLKO.1 1888 CDS 100% 0.495 0.347 N PCDHAC2 n/a
6 TRCN0000056018 GCCTGAAACATCTGTATTATA pLKO.1 4359 3UTR 100% 15.000 7.500 Y PCDHA8 n/a
7 TRCN0000094754 GCTGCTACAGAAGTGCTTTAA pLKO.1 4331 3UTR 100% 13.200 6.600 Y Pcdha5 n/a
8 TRCN0000094877 ACAAATTCATTATCCCAGGAT pLKO.1 3119 CDS 100% 2.640 1.320 Y Pcdha8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018899.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08627 pDONR223 100% 86.4% 84.3% None (many diffs) n/a
2 ccsbBroad304_08627 pLX_304 0% 86.4% 84.3% V5 (many diffs) n/a
3 TRCN0000476553 ATCTAGCACTGAAGTGGAGTCCTG pLX_317 12.1% 86.4% 84.3% V5 (many diffs) n/a
Download CSV