Transcript: Human NM_018913.2

Homo sapiens protocadherin gamma subfamily A, 10 (PCDHGA10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
PCDHGA10 (56106)
Length:
4617
CDS:
1..2811

Additional Resources:

NCBI RefSeq record:
NM_018913.2
NBCI Gene record:
PCDHGA10 (56106)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413198 TATCAACGGAAGCTCACTTTA pLKO_005 1307 CDS 100% 13.200 18.480 N PCDHGA10 n/a
2 TRCN0000053345 GCTGACCATCACGTCTCTATT pLKO.1 1050 CDS 100% 13.200 10.560 N PCDHGA10 n/a
3 TRCN0000424988 GTCTCCTACTTTACCTATATC pLKO_005 1375 CDS 100% 13.200 9.240 N PCDHGA10 n/a
4 TRCN0000417786 CACTCAGATCCTTCGACTATG pLKO_005 1559 CDS 100% 10.800 7.560 N PCDHGA10 n/a
5 TRCN0000053344 CCTACTCAATTCCTGAGGAAT pLKO.1 107 CDS 100% 4.950 3.465 N PCDHGA10 n/a
6 TRCN0000053347 CGAGTGAGTGTTCCTGAGAAT pLKO.1 754 CDS 100% 4.950 3.465 N PCDHGA10 n/a
7 TRCN0000053346 CCCAATAAGCACTTCTCCCTA pLKO.1 532 CDS 100% 2.640 1.848 N PCDHGA10 n/a
8 TRCN0000053343 CCGGTTTCTATGAAATAGAAA pLKO.1 947 CDS 100% 0.563 0.394 N PCDHGA10 n/a
9 TRCN0000053813 CCAGCCATAAACCAATAACTA pLKO.1 3712 3UTR 100% 5.625 2.813 Y PCDHGA2 n/a
10 TRCN0000203363 CCCAAGATCAATGCTCAAGTT pLKO.1 3357 3UTR 100% 4.950 2.475 Y PCDHGA7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01151 pDONR223 100% 13.9% 13.3% None (many diffs) n/a
2 ccsbBroad304_01151 pLX_304 0% 13.9% 13.3% V5 (many diffs) n/a
3 TRCN0000466539 CATGGTTCGGTAATGAAAGTTCCA pLX_317 36.4% 13.9% 13.3% V5 (many diffs) n/a
4 ccsbBroadEn_11019 pDONR223 100% 6.4% 6.4% None 1_2628del n/a
5 ccsbBroad304_11019 pLX_304 0% 6.4% 6.4% V5 1_2628del n/a
Download CSV