Transcript: Mouse NM_019468.2

Mus musculus glucose-6-phosphate dehydrogenase 2 (G6pd2), mRNA.

Source:
NCBI, updated 2019-02-21
Taxon:
Mus musculus (mouse)
Gene:
G6pd2 (14380)
Length:
1635
CDS:
42..1583

Additional Resources:

NCBI RefSeq record:
NM_019468.2
NBCI Gene record:
G6pd2 (14380)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019468.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041430 GAGACTGCAATTCCGAGATAT pLKO.1 1148 CDS 100% 13.200 9.240 N G6pd2 n/a
2 TRCN0000445567 ACCAGAAGTGCAAGCGTAATG pLKO_005 1186 CDS 100% 10.800 7.560 N G6pd2 n/a
3 TRCN0000041429 ACAGGCTTTAACCGCATCATA pLKO.1 525 CDS 100% 5.625 3.938 N G6pd2 n/a
4 TRCN0000041431 GATGGTCTTCTACCCAAAGAA pLKO.1 213 CDS 100% 5.625 3.938 N G6pd2 n/a
5 TRCN0000422992 CACAACGATGATGACCAAGAA pLKO_005 1244 CDS 100% 4.950 3.465 N G6pd2 n/a
6 TRCN0000041428 GCTACCACAGATTCAGATGAT pLKO.1 870 CDS 100% 4.950 3.465 N G6pd2 n/a
7 TRCN0000041432 CCGAGATATACCAGGCGACAT pLKO.1 1160 CDS 100% 4.050 2.835 N G6pd2 n/a
8 TRCN0000440595 CCTGCAGAGCTCCAATCAATT pLKO_005 569 CDS 100% 13.200 7.920 N G6pd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019468.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06235 pDONR223 100% 84.7% 86.7% None (many diffs) n/a
2 ccsbBroad304_06235 pLX_304 0% 84.7% 86.7% V5 (many diffs) n/a
3 TRCN0000467117 ATGTGTCCCAATCTGATGCATCTC pLX_317 30.1% 84.7% 86.7% V5 (many diffs) n/a
Download CSV