Transcript: Mouse NM_019473.1

Mus musculus olfactory receptor 155 (Olfr155), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr155 (29845)
Length:
1172
CDS:
20..979

Additional Resources:

NCBI RefSeq record:
NM_019473.1
NBCI Gene record:
Olfr155 (29845)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019473.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186349 CAGAACTTCCAACCTCTTCAT pLKO.1 991 3UTR 100% 4.950 3.465 N Olfr155 n/a
2 TRCN0000187929 GTCACAGTGCAGAACTTCCAA pLKO.1 982 3UTR 100% 3.000 2.100 N Olfr155 n/a
3 TRCN0000188629 CAAGCTCATCTCCCTCTTCTA pLKO.1 853 CDS 100% 4.950 2.475 Y Olfr157 n/a
4 TRCN0000204534 CCCTTAGATATCCTGTGGTCA pLKO.1 408 CDS 100% 2.640 1.320 Y Olfr159 n/a
5 TRCN0000187287 CCTTGTGACAATCCTGAGGAT pLKO.1 685 CDS 100% 2.640 1.320 Y Olfr155 n/a
6 TRCN0000187286 CGTGCAGATGTTTCTCTCCTT pLKO.1 316 CDS 100% 2.640 1.320 Y Olfr155 n/a
7 TRCN0000185843 GACAATGTCATCAATCACTTT pLKO.1 533 CDS 100% 4.950 2.475 Y Olfr159 n/a
8 TRCN0000188297 CGCCCATGTACTTCTTCCTAA pLKO.1 192 CDS 100% 4.950 2.475 Y Olfr281 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019473.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03733 pDONR223 100% 84.6% 82.1% None (many diffs) n/a
2 ccsbBroad304_03733 pLX_304 0% 84.6% 82.1% V5 (many diffs) n/a
3 TRCN0000468846 ATCCTCCCCGATCACTCGTGTCTT pLX_317 28.3% 84.6% 82.1% V5 (many diffs) n/a
Download CSV