Transcript: Mouse NM_019707.5

Mus musculus cadherin 13 (Cdh13), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cdh13 (12554)
Length:
3913
CDS:
244..2388

Additional Resources:

NCBI RefSeq record:
NM_019707.5
NBCI Gene record:
Cdh13 (12554)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019707.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094881 GCAACATCAAACTATCAGGTA pLKO.1 1764 CDS 100% 2.640 3.696 N Cdh13 n/a
2 TRCN0000094880 GCCTGTCCTAAACTTGACCTT pLKO.1 387 CDS 100% 2.640 2.112 N Cdh13 n/a
3 TRCN0000094879 CCTTCAAGTTTGAGATTCATA pLKO.1 2093 CDS 100% 5.625 3.938 N Cdh13 n/a
4 TRCN0000094883 GCTGCATACACCATCATCAAT pLKO.1 1435 CDS 100% 5.625 3.938 N Cdh13 n/a
5 TRCN0000094882 CCAGCGGAAAGTGTTACACAT pLKO.1 336 CDS 100% 4.950 3.465 N Cdh13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019707.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05976 pDONR223 100% 87% 92.8% None (many diffs) n/a
2 ccsbBroad304_05976 pLX_304 0% 87% 92.8% V5 (many diffs) n/a
3 TRCN0000481095 GGGCGAGTTATTGAAAATCGTATT pLX_317 16.4% 87% 92.8% V5 (many diffs) n/a
Download CSV