Transcript: Mouse NM_019788.3

Mus musculus biogenesis of lysosomal organelles complex-1, subunit 6, pallidin (Bloc1s6), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Bloc1s6 (18457)
Length:
3494
CDS:
119..637

Additional Resources:

NCBI RefSeq record:
NM_019788.3
NBCI Gene record:
Bloc1s6 (18457)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019788.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125574 GCTTAAAGAAAGGCATAACTT pLKO.1 1881 3UTR 100% 5.625 7.875 N Bloc1s6 n/a
2 TRCN0000316118 GCTTAAAGAAAGGCATAACTT pLKO_005 1881 3UTR 100% 5.625 7.875 N Bloc1s6 n/a
3 TRCN0000125576 CATGTTGGACATCAATGCTTT pLKO.1 409 CDS 100% 4.950 6.930 N Bloc1s6 n/a
4 TRCN0000304787 GACTTCCCTGTGGACGATAGA pLKO_005 239 CDS 100% 4.950 6.930 N Bloc1s6 n/a
5 TRCN0000125578 CTGTCCCACTACTTACCAGAT pLKO.1 287 CDS 100% 4.050 5.670 N Bloc1s6 n/a
6 TRCN0000381108 TTGTTCACAGAGGCGAAGCAC pLKO_005 428 CDS 100% 2.640 3.696 N Bloc1s6 n/a
7 TRCN0000380199 ATACACTGGAACAAGAGATTT pLKO_005 366 CDS 100% 13.200 9.240 N Bloc1s6 n/a
8 TRCN0000304786 CTCCAGATGAAGGACTGATAG pLKO_005 216 CDS 100% 10.800 7.560 N Bloc1s6 n/a
9 TRCN0000125575 CAGAACCAAGTTGTGTTACTA pLKO.1 344 CDS 100% 5.625 3.938 N Bloc1s6 n/a
10 TRCN0000304785 CGCCAAGCTGGTGACTATAAG pLKO_005 454 CDS 100% 13.200 7.920 N Bloc1s6 n/a
11 TRCN0000382045 ACTCCATGTTGGACATCAATG pLKO_005 405 CDS 100% 10.800 6.480 N Bloc1s6 n/a
12 TRCN0000125577 ACACAGAACCAAGTTGTGTTA pLKO.1 341 CDS 100% 0.495 0.248 Y Bloc1s6 n/a
13 TRCN0000316193 ACACAGAACCAAGTTGTGTTA pLKO_005 341 CDS 100% 0.495 0.248 Y Bloc1s6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019788.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02941 pDONR223 100% 82.1% 86.6% None (many diffs) n/a
2 ccsbBroad304_02941 pLX_304 0% 82.1% 86.6% V5 (many diffs) n/a
3 TRCN0000470905 ACGAGGCCTTTGGGCACCGACTAA pLX_317 75% 82.1% 86.6% V5 (many diffs) n/a
Download CSV