Transcript: Mouse NM_019914.4

Mus musculus myeloid/lymphoid or mixed-lineage leukemia; translocated to, 11 (Mllt11), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mllt11 (56772)
Length:
2514
CDS:
601..873

Additional Resources:

NCBI RefSeq record:
NM_019914.4
NBCI Gene record:
Mllt11 (56772)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019914.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201758 GCCTTTCTGTAGTTGCAGTAT pLKO.1 1741 3UTR 100% 4.950 3.960 N Mllt11 n/a
2 TRCN0000202173 CTGTCAGATACACCTACCTAC pLKO.1 694 CDS 100% 4.050 3.240 N Mllt11 n/a
3 TRCN0000189688 GTCAGATACACCTACCTACGA pLKO.1 696 CDS 100% 2.640 2.112 N Mllt11 n/a
4 TRCN0000191126 CGGAGCTGTTTATTCATTTAT pLKO.1 1880 3UTR 100% 15.000 10.500 N Mllt11 n/a
5 TRCN0000005655 CCTTGAGTACAGCACCTTCAA pLKO.1 798 CDS 100% 4.950 3.465 N MLLT11 n/a
6 TRCN0000349642 CCTTGAGTACAGCACCTTCAA pLKO_005 798 CDS 100% 4.950 3.465 N MLLT11 n/a
7 TRCN0000201886 CTACCTACGAGAGCAAGGATA pLKO.1 707 CDS 100% 4.950 3.465 N Mllt11 n/a
8 TRCN0000190016 GAGTACAGCACCTTCAACTTC pLKO.1 802 CDS 100% 4.950 3.465 N Mllt11 n/a
9 TRCN0000189873 CCTGTCAGATACACCTACCTA pLKO.1 693 CDS 100% 3.000 2.100 N Mllt11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019914.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02576 pDONR223 100% 87.9% 85.7% None (many diffs) n/a
2 ccsbBroad304_02576 pLX_304 0% 87.9% 85.7% V5 (many diffs) n/a
3 TRCN0000468457 TGCTGAATCACAGCTTAGTCACTA pLX_317 100% 87.9% 85.7% V5 (many diffs) n/a
4 TRCN0000489349 AACCCATTCCGCTCGGCCTCAACG pLX_317 100% 87.9% 85.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV