Transcript: Mouse NM_019975.3

Mus musculus 2-hydroxyacyl-CoA lyase 1 (Hacl1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Hacl1 (56794)
Length:
2618
CDS:
88..1833

Additional Resources:

NCBI RefSeq record:
NM_019975.3
NBCI Gene record:
Hacl1 (56794)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019975.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120063 GCGAGACTAAACTGGATCTTA pLKO.1 937 CDS 100% 5.625 4.500 N Hacl1 n/a
2 TRCN0000120066 GCTGACGTGATTGTGTTATTT pLKO.1 913 CDS 100% 15.000 10.500 N Hacl1 n/a
3 TRCN0000120065 CGCTGACGTGATTGTGTTATT pLKO.1 912 CDS 100% 13.200 9.240 N Hacl1 n/a
4 TRCN0000120062 CCCGCAAGGTAGAATTTACTT pLKO.1 1870 3UTR 100% 5.625 3.938 N Hacl1 n/a
5 TRCN0000120064 CCAATCATACTCTTGGTAGTA pLKO.1 1516 CDS 100% 4.950 3.465 N Hacl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019975.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02909 pDONR223 100% 85.5% 87.4% None (many diffs) n/a
2 ccsbBroad304_02909 pLX_304 0% 85.5% 87.4% V5 (many diffs) n/a
3 TRCN0000471578 AAGCTCCCGCCGAATCAGTCTAAG pLX_317 18.3% 85.5% 87.4% V5 (many diffs) n/a
4 ccsbBroadEn_11805 pDONR223 100% 18.4% 17.1% None (many diffs) n/a
5 TRCN0000465527 ACCATTAGCTTTGGCCTCTAATAT pLX_317 71.3% 18.4% 17.1% V5 (many diffs) n/a
Download CSV