Transcript: Human NM_020211.3

Homo sapiens repulsive guidance molecule BMP co-receptor a (RGMA), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
RGMA (56963)
Length:
11359
CDS:
280..1632

Additional Resources:

NCBI RefSeq record:
NM_020211.3
NBCI Gene record:
RGMA (56963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020211.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128608 CGACAATAATTACCTGAACGT pLKO.1 849 CDS 100% 2.640 3.696 N RGMA n/a
2 TRCN0000128983 GCTTAGAAAGTCGAAGTGCTT pLKO.1 2352 3UTR 100% 2.640 3.696 N RGMA n/a
3 TRCN0000425048 TGACTGGTGCCATGATGTTTG pLKO_005 1819 3UTR 100% 10.800 7.560 N RGMA n/a
4 TRCN0000418188 TGCCAGAGGAAGTGGTCAATG pLKO_005 1166 CDS 100% 10.800 7.560 N RGMA n/a
5 TRCN0000130653 CAAGATGCTCCACTCCAACAA pLKO.1 1482 CDS 100% 4.950 3.465 N RGMA n/a
6 TRCN0000425912 TGTTCTGCTAGACGCGTAGAT pLKO_005 1622 CDS 100% 4.950 3.465 N RGMA n/a
7 TRCN0000415762 AGTGCACGTGACAAGGTTGTG pLKO_005 1797 3UTR 100% 4.050 2.835 N RGMA n/a
8 TRCN0000128120 CTGCCATTACGAGAAGAGCTT pLKO.1 711 CDS 100% 2.640 1.848 N RGMA n/a
9 TRCN0000127524 CAGCCTGAAGATCACTGAGAA pLKO.1 1050 CDS 100% 4.950 2.970 N RGMA n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 7776 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000159082 GAAACCATCATTCTCAGCAAA pLKO.1 6940 3UTR 100% 4.950 2.475 Y ANKRD30B n/a
12 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 4702 3UTR 100% 1.080 0.540 Y GPR83 n/a
13 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 4702 3UTR 100% 1.080 0.540 Y MYORG n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7777 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 4574 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020211.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08678 pDONR223 100% 96.2% 96.2% None 1_48del;1317C>G;1349G>C n/a
2 ccsbBroad304_08678 pLX_304 0% 96.2% 96.2% V5 1_48del;1317C>G;1349G>C n/a
3 TRCN0000466660 AGCCGATCACTGAGGCTACCCGAG pLX_317 34.8% 96.2% 96.2% V5 1_48del;1317C>G;1349G>C n/a
Download CSV