Transcript: Human NM_020431.4

Homo sapiens transmembrane protein 63C (TMEM63C), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TMEM63C (57156)
Length:
5363
CDS:
174..2594

Additional Resources:

NCBI RefSeq record:
NM_020431.4
NBCI Gene record:
TMEM63C (57156)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020431.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440204 GCACTTGACGGATCGCTATAA pLKO_005 2066 CDS 100% 13.200 18.480 N TMEM63C n/a
2 TRCN0000165942 GCGTGTCCGTAAGGATTACAA pLKO.1 1235 CDS 100% 5.625 7.875 N TMEM63C n/a
3 TRCN0000158563 CCATCATGTGTATTTGGTGTA pLKO.1 4566 3UTR 100% 4.050 5.670 N TMEM63C n/a
4 TRCN0000439948 CAGTGACCACCATCGTCAAAT pLKO_005 1291 CDS 100% 13.200 9.240 N TMEM63C n/a
5 TRCN0000165343 GCCAAAGATGTGGCCACTTAA pLKO.1 3500 3UTR 100% 13.200 9.240 N TMEM63C n/a
6 TRCN0000434623 GGCTCTTTGACATCTACTATC pLKO_005 1729 CDS 100% 10.800 7.560 N TMEM63C n/a
7 TRCN0000158562 CCCTTCTTTCTATTCTTACAA pLKO.1 3264 3UTR 100% 5.625 3.938 N TMEM63C n/a
8 TRCN0000161176 GAAGACCCAGAACTCATCATT pLKO.1 867 CDS 100% 5.625 3.938 N TMEM63C n/a
9 TRCN0000162187 CAGAACATGACAGTGGATGAA pLKO.1 216 CDS 100% 4.950 3.465 N TMEM63C n/a
10 TRCN0000166392 CGTAGACCTGAGAAGAGGTAA pLKO.1 3183 3UTR 100% 4.950 3.465 N TMEM63C n/a
11 TRCN0000161340 GCTACATCTTTCTGGTGTTCA pLKO.1 1654 CDS 100% 4.950 3.465 N TMEM63C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020431.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08712 pDONR223 100% 99.9% 100% None 633A>G n/a
2 ccsbBroad304_08712 pLX_304 0% 99.9% 100% V5 633A>G n/a
3 TRCN0000477130 GAATTGTTCGAGTCTCTATTCGCG pLX_317 11.8% 99.9% 100% V5 633A>G n/a
Download CSV