Transcript: Human NM_020927.3

Homo sapiens vesicle amine transport 1 like (VAT1L), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
VAT1L (57687)
Length:
3791
CDS:
120..1379

Additional Resources:

NCBI RefSeq record:
NM_020927.3
NBCI Gene record:
VAT1L (57687)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020927.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146335 CCTAGTAAGTTGGGTAGAAAT pLKO.1 3198 3UTR 100% 13.200 18.480 N VAT1L n/a
2 TRCN0000183626 GCTCCATATCTGTTTCAATTT pLKO.1 2121 3UTR 100% 13.200 18.480 N VAT1L n/a
3 TRCN0000422848 GACTACGTGCAAGAAGTTAAA pLKO_005 819 CDS 100% 13.200 10.560 N VAT1L n/a
4 TRCN0000180754 GCGTCAAAGCCTGTGGATTAA pLKO.1 340 CDS 100% 13.200 10.560 N VAT1L n/a
5 TRCN0000427423 AGGGAACATTGGCAAGTTAAT pLKO_005 1229 CDS 100% 13.200 9.240 N VAT1L n/a
6 TRCN0000420479 TGGTGCGACAAGGGAATATTG pLKO_005 376 CDS 100% 13.200 9.240 N VAT1L n/a
7 TRCN0000415445 GGAGACCGTGTCATGGCATTT pLKO_005 486 CDS 100% 10.800 7.560 N VAT1L n/a
8 TRCN0000423359 TGGCTCATCCAACATGGTAAC pLKO_005 944 CDS 100% 6.000 4.200 N VAT1L n/a
9 TRCN0000147323 GCCTGTGGATTAAACTTCATT pLKO.1 348 CDS 100% 5.625 3.938 N VAT1L n/a
10 TRCN0000114317 GCCTCTACTTTCAAGCATGAA pLKO.1 756 CDS 100% 4.950 3.465 N Vat1l n/a
11 TRCN0000179532 GCCTATGTGATGCTGTTTGAA pLKO.1 621 CDS 100% 5.625 3.375 N VAT1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020927.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03840 pDONR223 100% 99.9% 100% None 468C>G n/a
2 ccsbBroad304_03840 pLX_304 0% 99.9% 100% V5 468C>G n/a
3 TRCN0000469530 CGCTACACTAATTACGTTCGAACC pLX_317 35.6% 99.9% 100% V5 468C>G n/a
Download CSV